Dataset for CDS BCL-2 of organism Oreochromis aureus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A668TEB6_BCL2-05      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
A0A668TEB6_BCL2-02      atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
A0A668TEB6_BCL2-03      --------------------------------------------------

A0A668TEB6_BCL2-05      -------------------------------atggcgaacgagtataatc
A0A668TEB6_BCL2-01      -------------------------------atg----ctgcttgttgtc
A0A668TEB6_BCL2-04      caatacctggtggctccttcttccgttcatcatg----ctgcttgttgtc
A0A668TEB6_BCL2-02      caatacctggtggctccttcttccgttcatcatg----ctgcttgttgtc
A0A668TEB6_BCL2-03      -------------------------------atg----ctgcttgttgtc
                                                       ***      *  * *  **

A0A668TEB6_BCL2-05      gc-------------aatattgtggaaaag-tatatctgccataaactct
A0A668TEB6_BCL2-01      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-04      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-02      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-03      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
                        **               * *****     * ***** **  **   * **

A0A668TEB6_BCL2-05      --------ccaagcggggatacgtgtggggatttcgcgttgt----ccaa
A0A668TEB6_BCL2-01      cattagtcccaagcctctaaaattgaacggggcccacgtcgtggtgacag
A0A668TEB6_BCL2-04      cattagtcccaagcctctaaaattgaacggggcccacgtcgtggtgacag
A0A668TEB6_BCL2-02      cattagtcccaagcctctaaaattgaacggggcccacgtcgtggtgacag
A0A668TEB6_BCL2-03      cattagtcccaagcctctaaaattgaacggggcccacgtcgtggtgacag
                                ******    * *  **   **    * *** **     ** 

A0A668TEB6_BCL2-05      gaaga---------------agatgc--tgctaataacggat-cgataac
A0A668TEB6_BCL2-01      gaggatccagtgggattgggaaatgcattgctattgagtgctacaagcaa
A0A668TEB6_BCL2-04      gaggatccagtgggattgggaaatgcattgctattgagtgctacaagcaa
A0A668TEB6_BCL2-02      gaggatccagtgggattgggaaatgcattgctattgagtgctacaagcaa
A0A668TEB6_BCL2-03      gaggatccagtgggattgggaaatgcattgctattgagtgctacaagcaa
                        ** **               * ****  ***** * *  * * * *  * 

A0A668TEB6_BCL2-05      tgaccctccaccgactttggt-tcac-cggtgccgagaagccagcaccgg
A0A668TEB6_BCL2-01      ggagcgttcatc-actttggtggcacgagacgaggagaagttgcttcagg
A0A668TEB6_BCL2-04      ggagcgttcatc-actttggtggcacgagacg------------------
A0A668TEB6_BCL2-02      ggagcgttcatc-actttggtggcacgagacgaggagaagttgcttcagg
A0A668TEB6_BCL2-03      ggagcgttcatc-actttggtggcacgagacgaggagaagttgcttcagg
                         ** * * ** * ********  ***  *  *                  

A0A668TEB6_BCL2-05      gcctgacggcgagagcaacacccacctct--------gcagacggctccc
A0A668TEB6_BCL2-01      caaagaaggaagtggagaaatttgccatcaatgacaagcaggtggtgctc
A0A668TEB6_BCL2-04      ---------------------------------------aggtggtgctc
A0A668TEB6_BCL2-02      caaagaaggaagtggagaaatttgccatcaatgacaagcaggtggtgctc
A0A668TEB6_BCL2-03      caaagaaggaagtggagaaatttgccatcaatgacaagcaggtggtgctc
                                                               **  **  * *

A0A668TEB6_BCL2-05      acagtccgacccacacgcaggcatccacagagtcctgcgcgaggctggag
A0A668TEB6_BCL2-01      ----tgcatctcagttg-atgtttccagtgattac------agtcaagtg
A0A668TEB6_BCL2-04      ----tgcatctcagttg-atgtttccagtgattac------agtcaagtg
A0A668TEB6_BCL2-02      ----tgcatctcagttg-atgtttccagtgattac------agtcaagtg
A0A668TEB6_BCL2-03      ----tgcatctcagttg-atgtttccagtgattac------agtcaagtg
                            * *  * **   * * *  ****  ** * *      ** *  * *

A0A668TEB6_BCL2-05      atgaacttgaaagactgtacc-------agccggacttcacggagatgtc
A0A668TEB6_BCL2-01      gaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatg-c
A0A668TEB6_BCL2-04      gaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatg-c
A0A668TEB6_BCL2-02      gaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatg-c
A0A668TEB6_BCL2-03      gaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatg-c
                           *** *** * *     *        ***  *        ** *** *

A0A668TEB6_BCL2-05      gcggcagctgcatctcacctccgccacggcgcagaggaggttcgccgagg
A0A668TEB6_BCL2-01      ttgtgaactgcgctggaactt-----cagtttctgggaagtttgaggaag
A0A668TEB6_BCL2-04      ttgtgaactgcgctggaactt-----cagtttctgggaagtttgaggaag
A0A668TEB6_BCL2-02      ttgtgaactgcgctggaactt-----cagtttctgggaagtttgaggaag
A0A668TEB6_BCL2-03      ttgtgaactgcgctggaactt-----cagtttctgggaagtttgaggaag
                          *  * ****     * **      * *      *** *** *  ** *

A0A668TEB6_BCL2-05      tgatagacgaactgttccgggac-------ggagtgaactg---------
A0A668TEB6_BCL2-01      tgg-aggtagatcgttttaaaaaattgatggaagtgaactacctgggcag
A0A668TEB6_BCL2-04      tgg-aggtagatcgttttaaa-----------------------------
A0A668TEB6_BCL2-02      tgg-aggtagatcgttttaaaaaattgatggaagtgaactacctgggcag
A0A668TEB6_BCL2-03      tgg-aggtagatcgttttaaaaaattgatggaagtgaactacctgggcag
                        **  **    *  ***                                  

A0A668TEB6_BCL2-05      ------------------------------------------------gg
A0A668TEB6_BCL2-01      cgtttacccaacacgagccgtcataaccaccatgaaggagcgaagaatgg
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      cgtttacccaacacgagccgtcataaccaccatgaaggagcgaagaatgg
A0A668TEB6_BCL2-03      cgtttacccaacacgagccgtcataaccaccatgaaggagcgaagaatgg

A0A668TEB6_BCL2-05      gccggatta---ttgctttcttcga------------------gtttggg
A0A668TEB6_BCL2-01      gccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggt
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      gccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggt
A0A668TEB6_BCL2-03      gccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggt

A0A668TEB6_BCL2-05      ggcacggtgtgc--------------------------------------
A0A668TEB6_BCL2-01      tacactgcctactccccatctaagtttgccctgcgaggccttgcagagtc
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tacactgcctactccccatctaagtttgccctgcgaggccttgcagagtc
A0A668TEB6_BCL2-03      tacactgcctactccccatctaagtttgccctgcgaggccttgcagagtc

A0A668TEB6_BCL2-05      ----------------------------------------gtggaatgcg
A0A668TEB6_BCL2-01      gctgcagatggagataaagccctacaatatctacgtgactgtggcatacc
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      gctgcagatggagataaagccctacaatatctacgtgactgtggcatacc
A0A668TEB6_BCL2-03      gctgcagatggagataaagccctacaatatctacgtgactgtggcatacc

A0A668TEB6_BCL2-05      cttccaac---------------------gagggga--------------
A0A668TEB6_BCL2-01      cccctgacactgacactccaggactggctgaagagaacaagacaaaacct
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      cccctgacactgacactccaggactggctgaagagaacaagacaaaacct
A0A668TEB6_BCL2-03      cccctgacactgacactccaggactggctgaagagaacaagacaaaacct

A0A668TEB6_BCL2-05      ------------------------------------tgtcatc----cca
A0A668TEB6_BCL2-01      ctggagaccaaattaatctctgaaacctctggagtttgtcaaccagacca
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ctggagaccaaattaatctctgaaacctctggagtttgtcaaccagacca
A0A668TEB6_BCL2-03      ctggagaccaaattaatctctgaaacctctggagtttgtcaaccagacca

A0A668TEB6_BCL2-05      ggtggacaacatcgcagactgga------tgacggagtatttaaatggac
A0A668TEB6_BCL2-01      agtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagct
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      agtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagct
A0A668TEB6_BCL2-03      agtggccaaaatcattgtcagggatgca----------------------

A0A668TEB6_BCL2-05      ctcttaa--cagctggatacaagataacgggg------------------
A0A668TEB6_BCL2-01      ctgtcggtccagatggttacatgctatcagcgctcacctgtggaatgtca
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ctgtcggtccagatggttacatgctatcagcgctcacctgtggaatgtca
A0A668TEB6_BCL2-03      --------------------------------------------------

A0A668TEB6_BCL2-05      ----------------------------gatgggatgcatttgtggagct
A0A668TEB6_BCL2-01      cccgtcacctccatcacagagggtctccagcaggatgcatttgtggagct
A0A668TEB6_BCL2-04      ---------------------------------attgtcaccatgggatt
A0A668TEB6_BCL2-02      cccgtcacctccatcacagagggtctccagcagattgtcaccatgggatt
A0A668TEB6_BCL2-03      ---------------------------------attgtcaccatgggatt
                                                           **      ***   *

A0A668TEB6_BCL2-05      gtacgacagacagagggactccgtcttcagctgctcctggccctccatca
A0A668TEB6_BCL2-01      gtacgacagacagagggactccgtcttcagctgctcctggccctccatca
A0A668TEB6_BCL2-04      gttt--cggaccatcgcact---tttttacctg----gggagcttt----
A0A668TEB6_BCL2-02      gttt--cggaccatcgcact---tttttacctg----gggagcttt----
A0A668TEB6_BCL2-03      gttt--cggaccatcgcact---tttttacctg----gggagcttt----
                        **    * ***    * ***   * ** * ***     **  **      

A0A668TEB6_BCL2-05      agacagttttcggcttggctgc---gctcggagcggccagtctcaccatc
A0A668TEB6_BCL2-01      agacagttttcggcttggctgc---gctcggagcggccagtctcaccatc
A0A668TEB6_BCL2-04      -gacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaa-----
A0A668TEB6_BCL2-02      -gacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaa-----
A0A668TEB6_BCL2-03      -gacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaa-----
                         *****  *   **   ****      **  ** *  *****  *     

A0A668TEB6_BCL2-05      ggagcataccttacacaaaagtga
A0A668TEB6_BCL2-01      ggagcataccttacacaaaagtga
A0A668TEB6_BCL2-04      --agcggccaataagagggagtaa
A0A668TEB6_BCL2-02      --agcggccaataagagggagtaa
A0A668TEB6_BCL2-03      --agcggccaataagagggagtaa
                          ***   *  **      *** *

© 1998-2021Legal notice