Dataset for CDS BCL2L1 of organism Epinephelus coioides

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A510BW31_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcagaggaaccacccgacctctctact
gaggccagagggtgctgaaggaaggaccgagcgagacaaggccagctcagctgccagtaacggcttgctggtcaacagca
ggaatgggggcagccagccggggacttcatcacccccgcatggtgacatagaagctgtaaaggcagctctgcgggactca
gcagatgagtttgaactgcttttcacgcaatcatttagtgacctttcctcgcagctagacatcactcctgacacagccta
ccacagctttaagagtgtgatggacgaggtgttcaaggatggagtcaactggggacgtgtagtgggcctgtttgcctttg
gcggtgtgctgtgtgtggaatgtgtagagaaggatatgagtgagctggtttcccgcatcacagactggatgaccacgtac
ctggatgagcacatcaatccatggatccagacccaaggaggatgggactgctttgctgagatttttgggcagaacagcgc
tgcagaagcgaggcgatctcaggagagtctgagaagatggctgctagttggagtcgcgctgctcatgggagtgctggtcg
gtgtggtcatcgccaagaatcactga
© 1998-2021Legal notice