Dataset for CDS BCL2L1 of organism Epinephelus coioides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A219P0Y3_BCL2L1-      atgtgtcaa---aacagagaactggtggtttgctacataaaatataaact
A0A510BW31_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagct
                        ****   *    ******** *******  * **   ***  ** ** **

A0A219P0Y3_BCL2L1-      aacccagagaaactat----cctctcaaccacatgggactcatagagcct
A0A510BW31_BCL2L1-      gtctcagaggaaccacccgacctctctac----tgaggccagagggtgct
                          * ***** *** *     ****** **    ** * *     *   **

A0A219P0Y3_BCL2L1-      ccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggt
A0A510BW31_BCL2L1-      gaaggaaggaccga-----gcgagacaaggccagct---cagctgccagt
                          *   ***** **     * *** ** **  ** *    *** **  **

A0A219P0Y3_BCL2L1-      agcgacacac--gccaacgggacttttaatggcatgagtcccgggacccc
A0A510BW31_BCL2L1-      aacggcttgctggtcaacagcaggaatgggggcagccagccggggact--
                        * ** *   *  * **** * *    *   ****     ** *****   

A0A219P0Y3_BCL2L1-      gccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctgg
A0A510BW31_BCL2L1-      -tcatcacccccgc-atggtgaca-----------------------tag
                          ** ** ******   **   **                       * *

A0A219P0Y3_BCL2L1-      acgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcga
A0A510BW31_BCL2L1-      aagctgtaaaggcagctctgcgggactcagcagatgagtttgaactgctt
                        * ** ** ** *  ** ** ******** **  * ******** ****  

A0A219P0Y3_BCL2L1-      tacgctcgcgccttcagcgatctgcaccaccagctgcacatcacgccggc
A0A510BW31_BCL2L1-      ttcacgcaatcatttagtgacctttcctcgcagctagacatcactcctga
                        * * * *   * ** ** ** **   *   *****  ******* ** * 

A0A219P0Y3_BCL2L1-      cacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacg
A0A510BW31_BCL2L1-      cacagcctaccacagctttaagagtgtgatggacgaggtgttcaaggatg
                        ************ *****  ***  ******** *********  *** *

A0A219P0Y3_BCL2L1-      gagtcaactggggccgcatcgtagggcttttcgctttcggcggggcgctg
A0A510BW31_BCL2L1-      gagtcaactggggacgtgtagtgggcctgtttgcctttggcggtgtgctg
                        ************* **  * ** ** ** ** ** ** ***** * ****

A0A219P0Y3_BCL2L1-      tgcgtggagtgcgttgagaaggagatgagtccgttggtgggcaggatcat
A0A510BW31_BCL2L1-      tgtgtggaatgtgtagagaaggatatgagtgagctggtttcccgcatcac
                        ** ***** ** ** ******** ******  * ****   * * **** 

A0A219P0Y3_BCL2L1-      agagtggaagacccgctatctggacaaccacattcagccctggatccaga
A0A510BW31_BCL2L1-      agactggatgaccacgtacctggatgagcacatcaatccatggatccaga
                        *** **** ****   ** *****  * *****  * ** **********

A0A219P0Y3_BCL2L1-      gccaaagaggatgggagcgcttcgccgaaatcttcgggcaggacgcggcg
A0A510BW31_BCL2L1-      cccaaggaggatgggactgctttgctgagatttttgggcagaacagcgct
                         **** **********  **** ** ** ** ** ****** **   ** 

A0A219P0Y3_BCL2L1-      gcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcggg
A0A510BW31_BCL2L1-      gcagaagcgaggcgatctcaggagagtctgagaagatggctgctagttgg
                        *****    *** * ************ * * **  ******** *  **

A0A219P0Y3_BCL2L1-      gatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaac
A0A510BW31_BCL2L1-      agtcgcgctgctcatgggagtgctggtcggtgtggtcatcgccaagaatc
                          *  * *** * *  *****  **** **     ******** **** *

A0A219P0Y3_BCL2L1-      gcctgtga
A0A510BW31_BCL2L1-      ac---tga
                         *   ***

© 1998-2020Legal notice