Dataset for CDS Unclassified of organism Mizuhopecten yessoensis

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A210PFJ2_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=678 residues).
atggctacggaaggaattcaaatggggtcgaactaccctgttaaaggaaatttgttcgctgaaattcataaacagctggg
gcttatgccaggttttaagggacttggacaggatatgagtaagttagatcaacaaacacagacgcccggtagtgcttctc
ccttggaaaagatcagactagaatctgaggttattgcaactgatgttatcagcagttttggacttgaagagtgtaagaaa
cctatggacagatattgcaaaacaatgcgtagaaatgttcaggaattatcagaccgacatgagattgcattcaagggaat
ggtcaacaagctaaacgttgacgattcaaatgcttttccaacatttgtgtctgtggtagatgaaatttttgaggatggac
aaattaactggggtagaattgttgctgtttacacattcgcatctcggttagcattgcattgtcgcgtaaacactccagat
tgtgatgaaagaatagctttgtatgcagggaaatatgttgctagcaaactagggagatggattcttgataatggaggatg
ggatgcctttgcggattatttccctgaacagggtgcaatggaagacaaactttggaagggattggtctatactgccatgg
gcctcggagctttagccaccatggtggccacaaggtga
>gnl|bcl2dbcds|A0A210Q8F1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=2283 residues).
atggagaagaacataacaaggactccgtccttccaggaggcatcagatctactcaaggtccacctccagaagaaacaccg
cctcaaacgccattctccctgccctcctcagccacccactaaacaggaggtccgcaatgaggctgcaatgattctagaac
agtttcttttgaaggaactgaaagaaaacaagggcaaacatggcaaaccactgatagggacagcatatcagcaggtgaag
gatgtggatgttacagaggaggagtactacctccataactcctatcactcccaccagggggcaccactgtcccctgacag
ctccagcgacaggcatcaccaattcggcacctctggtcatgcaggtcacacatcggtaatccactctcgtggacactcag
aactctcccatgcttcattgacctccggtaaaacatcgtctgtgattcattcccgtgaaacatccgaaatttctcgtact
tccattaactctgctaaaacttccatccactcattgttagatgagaataatgatataccttttgctgatgatcatgtcac
agtgcctcgggcaaaaagtttgccacccgatctgtctccagctcacagaattgataataacataatgacaacatcatact
cgttgagtccctctaagctagagaatttggacaaaaataaggacattgtggatttaaagaaaaaaggcagagacagagct
tcaaggcctgtaaatggaaattcatcatcgaccgtcatcactagggggcgccagcggtacaaatcagggtctatatcctc
ctcggacactgagagtgatgcaatttcacaagatagaaagaaaaaatctgtgttcaaaagagcgaaagaaaggctaaata
gtgtgttgaacagaagtaaagacagaaagacagaagacagggagggtgactttgtaacaaagaaggggaaccatggtcaa
aacaaaaggagcggggctaaggttttggaagaaaagcacacccacaaacatggacatgtagaacagcatcattacacgga
tggggatcggacagggctggttaggtcgcaggagatgtgggagtcgacagacatcacagaccaggaacacaacaagcaca
aacacattgacaaacactgcaagatgaaagagagcgctgatctgtccagttcagcaaagatatccgagggtggaatcttc
agcagtctccgcaaactgacttcacgacgaggcaagaagtcgaggaagaaagttccaggatcaaagtctgcagacttcag
catgttaaagaagaaaaagaagaagaaagcatattcaaggaatatctctgttcctgatggacctctgagagattgggaca
acagtcattttgagtcaacctctttcgaagtggatgggcgacggacaaaacatacaacacatgtaacctcaatagatgat
gtgggacttaatgcaatcagcaatctggacattggtcaagggtccgaaccgatggacgtagaagatgggggtcttcctac
caaccagtcgtttgcttatgactatgatattgatgagacagaattccgaagaagactgcttactggggaaatagacattg
agcggaacatctaccaacatcatactgatacattagtggatgaccttgatgtggatggaaatacacatccagatgatgaa
gatgaaaggccacagtcatctgcaggagctgtggggtctccggagggaggggaggatcctacccaggaggataaggagaa
attgtatgggattatagctgaacggctggcagagatgggggatagctacatggcaggggcttctggtgaagcccatgcag
cctcgcctcgacgaacctcaagttcagctcaagcctctcttgaagcatcgtatgatgtcagagacggtgatggtcttaat
tcactggaaagagaacttagagacagcttgcgaaactttggagacaattttagtgttgagcacccggtgtcagctgaagt
tacggaggcagcggtggacatagtcagacaggcgacctacaacacatttacagatacacttaaacgtgccatcggggatg
aggtaggctgggaccagctcgccacgcttttctacatcacgaaaaaaacagtcaaggctgcgggggtcggaggggctgtg
gccctcaaggtcaaggagatgagtctacgttacctggaggataagtttgctggctggattgttgaccagggtggatggga
caccgtcctggaatcggagagtacagattctgaactggattga
>gnl|bcl2dbcds|A0A210Q8F1_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=2283 residues).
atggagaagaacataacaaggactccgtccttccaggaggcatcagatctactcaaggtccacctccagaagaaacaccg
cctcaaacgccattctccctgccctcctcagccacccactaaacaggaggtccgcaatgaggctgcaatgattctagaac
agtttcttttgaaggaactgaaagaaaacaagggcaaacatggcaaaccactgatagggacagcatatcagcaggtgaag
gatgtggatgttacagaggaggagtactacctccataactcctatcactcccaccagggggcaccactgtcccctgacag
ctccagcgacaggcatcaccaattcggcacctctggtcatgcaggtcacacatcggtaatccactctcgtggacactcag
aactctcccatgcttcattgacctccggtaaaacatcgtctgtgattcattcccgtgaaacatccgaaatttctcgtact
tccattaactctgctaaaacttccatccactcattgttagatgagaataatgatataccttttgctgatgatcatgtcac
agtgcctcgggcaaaaagtttgccacccgatctgtctccagctcacagaattgataataacataatgacaacatcatact
cgttgagtccctctaagctagagaatttggacaaaaataaggacattgtggatttaaagaaaaaaggcagagacagagct
tcaaggcctgtaaatggaaattcatcatcgaccgtcatcactagggggcgccagcggtacaaatcagggtctatatcctc
ctcggacactgagagtgatgcaatttcacaagatagaaagaaaaaatctgtgttcaaaagagcgaaagaaaggctaaata
gtgtgttgaacagaagtaaagacagaaagacagaagacagggagggtgactttgtaacaaagaaggggaaccatggtcaa
aacaaaaggagcggggctaaggttttggaagaaaagcacacccacaaacatggacatgtagaacagcatcattacacgga
tggggatcggacagggctggttaggtcgcaggagatgtgggagtcgacagacatcacagaccaggaacacaacaagcaca
aacacattgacaaacactgcaagatgaaagagagcgctgatctgtccagttcagcaaagatatccgagggtggaatcttc
agcagtctccgcaaactgacttcacgacgaggcaagaagtcgaggaagaaagttccaggatcaaagtctgcagacttcag
catgttaaagaagaaaaagaagaagaaagcatattcaaggaatatctctgttcctgatggacctctgagagattgggaca
acagtcattttgagtcaacctctttcgaagtggatgggcgacggacaaaacatacaacacatgtaacctcaatagatgat
gtgggacttaatgcaatcagcaatctggacattggtcaagggtccgaaccgatggacgtagaagatgggggtcttcctac
caaccagtcgtttgcttatgactatgatattgatgagacagaattccgaagaagactgcttactggggaaatagacattg
agcggaacatctaccaacatcatactgatacattagtggatgaccttgatgtggatggaaatacacatccagatgatgaa
gatgaaaggccacagtcatctgcaggagctgtggggtctccggagggaggggaggatcctacccaggaggataaggagaa
attgtatgggattatagctgaacggctggcagagatgggggatagctacatggcaggggcttctggtgaagcccatgcag
cctcgcctcgacgaacctcaagttcagctcaagcctctcttgaagcatcgtatgatgtcagagacggtgatggtcttaat
tcactggaaagagaacttagagacagcttgcgaaactttggagacaattttagtgttgagcacccggtgtcagctgaagt
tacggaggcagcggtggacatagtcagacaggcgacctacaacacatttacagatacacttaaacgtgccatcggggatg
aggtaggctgggaccagctcgccacgcttttctacatcacgaaaaaaacagtcaaggctgcgggggtcggaggggctgtg
gccctcaaggtcaaggagatgagtctacgttacctggaggataagtttgctggctggattgttgaccagggtggatggga
caccgtcctggaatcggagagtacagattctgaactggattga
>gnl|bcl2dbcds|A0A210Q8F1_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=2283 residues).
atggagaagaacataacaaggactccgtccttccaggaggcatcagatctactcaaggtccacctccagaagaaacaccg
cctcaaacgccattctccctgccctcctcagccacccactaaacaggaggtccgcaatgaggctgcaatgattctagaac
agtttcttttgaaggaactgaaagaaaacaagggcaaacatggcaaaccactgatagggacagcatatcagcaggtgaag
gatgtggatgttacagaggaggagtactacctccataactcctatcactcccaccagggggcaccactgtcccctgacag
ctccagcgacaggcatcaccaattcggcacctctggtcatgcaggtcacacatcggtaatccactctcgtggacactcag
aactctcccatgcttcattgacctccggtaaaacatcgtctgtgattcattcccgtgaaacatccgaaatttctcgtact
tccattaactctgctaaaacttccatccactcattgttagatgagaataatgatataccttttgctgatgatcatgtcac
agtgcctcgggcaaaaagtttgccacccgatctgtctccagctcacagaattgataataacataatgacaacatcatact
cgttgagtccctctaagctagagaatttggacaaaaataaggacattgtggatttaaagaaaaaaggcagagacagagct
tcaaggcctgtaaatggaaattcatcatcgaccgtcatcactagggggcgccagcggtacaaatcagggtctatatcctc
ctcggacactgagagtgatgcaatttcacaagatagaaagaaaaaatctgtgttcaaaagagcgaaagaaaggctaaata
gtgtgttgaacagaagtaaagacagaaagacagaagacagggagggtgactttgtaacaaagaaggggaaccatggtcaa
aacaaaaggagcggggctaaggttttggaagaaaagcacacccacaaacatggacatgtagaacagcatcattacacgga
tggggatcggacagggctggttaggtcgcaggagatgtgggagtcgacagacatcacagaccaggaacacaacaagcaca
aacacattgacaaacactgcaagatgaaagagagcgctgatctgtccagttcagcaaagatatccgagggtggaatcttc
agcagtctccgcaaactgacttcacgacgaggcaagaagtcgaggaagaaagttccaggatcaaagtctgcagacttcag
catgttaaagaagaaaaagaagaagaaagcatattcaaggaatatctctgttcctgatggacctctgagagattgggaca
acagtcattttgagtcaacctctttcgaagtggatgggcgacggacaaaacatacaacacatgtaacctcaatagatgat
gtgggacttaatgcaatcagcaatctggacattggtcaagggtccgaaccgatggacgtagaagatgggggtcttcctac
caaccagtcgtttgcttatgactatgatattgatgagacagaattccgaagaagactgcttactggggaaatagacattg
agcggaacatctaccaacatcatactgatacattagtggatgaccttgatgtggatggaaatacacatccagatgatgaa
gatgaaaggccacagtcatctgcaggagctgtggggtctccggagggaggggaggatcctacccaggaggataaggagaa
attgtatgggattatagctgaacggctggcagagatgggggatagctacatggcaggggcttctggtgaagcccatgcag
cctcgcctcgacgaacctcaagttcagctcaagcctctcttgaagcatcgtatgatgtcagagacggtgatggtcttaat
tcactggaaagagaacttagagacagcttgcgaaactttggagacaattttagtgttgagcacccggtgtcagctgaagt
tacggaggcagcggtggacatagtcagacaggcgacctacaacacatttacagatacacttaaacgtgccatcggggatg
aggtaggctgggaccagctcgccacgcttttctacatcacgaaaaaaacagtcaaggctgcgggggtcggaggggctgtg
gccctcaaggtcaaggagatgagtctacgttacctggaggataagtttgctggctggattgttgaccagggtggatggga
caccgtcctggaatcggagagtacagattctgaactggattga
>gnl|bcl2dbcds|A0A210Q8F1_uncBCL2L1-04 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=2283 residues).
atggagaagaacataacaaggactccgtccttccaggaggcatcagatctactcaaggtccacctccagaagaaacaccg
cctcaaacgccattctccctgccctcctcagccacccactaaacaggaggtccgcaatgaggctgcaatgattctagaac
agtttcttttgaaggaactgaaagaaaacaagggcaaacatggcaaaccactgatagggacagcatatcagcaggtgaag
gatgtggatgttacagaggaggagtactacctccataactcctatcactcccaccagggggcaccactgtcccctgacag
ctccagcgacaggcatcaccaattcggcacctctggtcatgcaggtcacacatcggtaatccactctcgtggacactcag
aactctcccatgcttcattgacctccggtaaaacatcgtctgtgattcattcccgtgaaacatccgaaatttctcgtact
tccattaactctgctaaaacttccatccactcattgttagatgagaataatgatataccttttgctgatgatcatgtcac
agtgcctcgggcaaaaagtttgccacccgatctgtctccagctcacagaattgataataacataatgacaacatcatact
cgttgagtccctctaagctagagaatttggacaaaaataaggacattgtggatttaaagaaaaaaggcagagacagagct
tcaaggcctgtaaatggaaattcatcatcgaccgtcatcactagggggcgccagcggtacaaatcagggtctatatcctc
ctcggacactgagagtgatgcaatttcacaagatagaaagaaaaaatctgtgttcaaaagagcgaaagaaaggctaaata
gtgtgttgaacagaagtaaagacagaaagacagaagacagggagggtgactttgtaacaaagaaggggaaccatggtcaa
aacaaaaggagcggggctaaggttttggaagaaaagcacacccacaaacatggacatgtagaacagcatcattacacgga
tggggatcggacagggctggttaggtcgcaggagatgtgggagtcgacagacatcacagaccaggaacacaacaagcaca
aacacattgacaaacactgcaagatgaaagagagcgctgatctgtccagttcagcaaagatatccgagggtggaatcttc
agcagtctccgcaaactgacttcacgacgaggcaagaagtcgaggaagaaagttccaggatcaaagtctgcagacttcag
catgttaaagaagaaaaagaagaagaaagcatattcaaggaatatctctgttcctgatggacctctgagagattgggaca
acagtcattttgagtcaacctctttcgaagtggatgggcgacggacaaaacatacaacacatgtaacctcaatagatgat
gtgggacttaatgcaatcagcaatctggacattggtcaagggtccgaaccgatggacgtagaagatgggggtcttcctac
caaccagtcgtttgcttatgactatgatattgatgagacagaattccgaagaagactgcttactggggaaatagacattg
agcggaacatctaccaacatcatactgatacattagtggatgaccttgatgtggatggaaatacacatccagatgatgaa
gatgaaaggccacagtcatctgcaggagctgtggggtctccggagggaggggaggatcctacccaggaggataaggagaa
attgtatgggattatagctgaacggctggcagagatgggggatagctacatggcaggggcttctggtgaagcccatgcag
cctcgcctcgacgaacctcaagttcagctcaagcctctcttgaagcatcgtatgatgtcagagacggtgatggtcttaat
tcactggaaagagaacttagagacagcttgcgaaactttggagacaattttagtgttgagcacccggtgtcagctgaagt
tacggaggcagcggtggacatagtcagacaggcgacctacaacacatttacagatacacttaaacgtgccatcggggatg
aggtaggctgggaccagctcgccacgcttttctacatcacgaaaaaaacagtcaaggctgcgggggtcggaggggctgtg
gccctcaaggtcaaggagatgagtctacgttacctggaggataagtttgctggctggattgttgaccagggtggatggga
caccgtcctggaatcggagagtacagattctgaactggattga
>gnl|bcl2dbcds|A0A210QQK5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=588 residues).
atgagtttaaacaacaatattgagatgaacccgacgagttataggtacctggtggtcgatttcataaattaccggctgag
ccgacatggatatacatgggataactgtccacctttgcaagctcgaacaaataatgttcacagaactttgcgagcgcttg
gtgatgaatttcaagagcggtttaggactcagtttgatgatatggtgaatcagttacatattacgccgaatacagcatac
ccgaccttccatcaggtggttcaagagctgttcattgacggtgtaaattggggtcgaatcgtagctttattcggattcgg
aggtgcaatagcagtagactgtgttaataaagggatgccacatttagtcgattccatcgtggagtgggtctcaacatata
tagaaaataatctggaccaatgggttactaccagtggaggttgggatggtttcgtggaattctatgagaaaggaaacaca
cggaggagggaaagcccctgggacaacatatctggtgttatcaaatacggcatgctgggagcgatcggcgctgtggccct
cggggcaattcttactcagagaacgtga
>gnl|bcl2dbcds|A0A210QQK5_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Mizuhopecten yessoensis (length=606 residues).
atgatggaagtcgtgaaaattaattggaaaactaaacgtgaaatgaatccaacagcttcgaggtatcttgtggtggatta
cataaactaccggcttactaaacaaggaataacatgggcgaactgtcctcctcttttgagccagccgacagaaattcata
caacgttacgtaaaatgggcgatgaattcgaggagagatacgcagttcagttttcagatctaggaagtcagcttaatatg
agtcaatataatgcatatcccacgttcaacacggcagtcggagaattatttcatgatggtgtaaactggggcaggattgt
agccctcttcgctttcagtggtacgctagcgaaaaagttctgtcaacaacaaatgatggaccttgtgtcgtcattaattg
actggacgtcacaatatctggacaatcagttagaaaactggattgaaagtcatggtggatgggatggtttcgtggaattc
tatgagaaaggaaacacacggaggagggaaagcccctgggacaacatatctggtgttatcaaatacggcatgctgggagc
gatcggcgctgtggccctcggggcaattcttactcagagaacgtga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice