Dataset for CDS MCL-1 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3GJZ3_MCL1-01      atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgg
A0A2I3GJZ3_MCL1-02      atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2I3GJZ3_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2I3GJZ3_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2I3GJZ3_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2I3GJZ3_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
                        **************************************************

A0A2I3GJZ3_MCL1-01      ggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtc
A0A2I3GJZ3_MCL1-02      ggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtc
                        **************************************************

A0A2I3GJZ3_MCL1-01      agtcctcacaccagactcccggagggtcgcgcggccgccgcccattggcg
A0A2I3GJZ3_MCL1-02      agtcctcacaccagactcccggagggtcgcgcggccgccgcccattggcg
                        **************************************************

A0A2I3GJZ3_MCL1-01      ccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgct
A0A2I3GJZ3_MCL1-02      ccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgct
                        **************************************************

A0A2I3GJZ3_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2I3GJZ3_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
                        **************************************************

A0A2I3GJZ3_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2I3GJZ3_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
                        **************************************************

A0A2I3GJZ3_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2I3GJZ3_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
                        **************************************************

A0A2I3GJZ3_MCL1-01      ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
A0A2I3GJZ3_MCL1-02      ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
                        **************************************************

A0A2I3GJZ3_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctc
A0A2I3GJZ3_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctc
                        **************************************************

A0A2I3GJZ3_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2I3GJZ3_MCL1-02      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                        **************************************************

A0A2I3GJZ3_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
A0A2I3GJZ3_MCL1-02      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
                        **************************************************

A0A2I3GJZ3_MCL1-01      ggatggcgtgcagcgcaaccatgagacggccttccaa-------------
A0A2I3GJZ3_MCL1-02      ggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgga
                        *************************************             

A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatg
                                                                          

A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
                                                                          

A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
                                                                          

A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                          

A0A2I3GJZ3_MCL1-01      -----------------------------------ggatgggtttgtgga
A0A2I3GJZ3_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                                                           ***************

A0A2I3GJZ3_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2I3GJZ3_MCL1-02      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
                        **************************************************

A0A2I3GJZ3_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2I3GJZ3_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

A0A2I3GJZ3_MCL1-01      tagccttactgtaa
A0A2I3GJZ3_MCL1-02      tag-----------
                        ***           

© 1998-2020Legal notice