Dataset for CDS BCL-2-like of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KHH8_BCL2A1-      atgacag-------------------------------------------
A0A2K5KHH8_BCL2A1-      atgacag-------------------------------------------
A0A2K5NZS5_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      atgtctc------------------agagcaaccgggagctggtggttga
A0A2K5MMZ4_BCL2L10      atggctg-------------------------------------------
A0A2K5LXU8_MCL1-01      atg-----------------------------------------------
A0A2K5LXU8_MCL1-03      atg-----------------------------------------------
A0A2K5MZX9_BCL2L2-      atggcga-------------------------------------------
A0A2K5MZX9_BCL2L2-      atggcga-------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------actgtgaatttggatatatttacag--gctagctcaggact-
A0A2K5KHH8_BCL2A1-      --------actgtgaatttggatatatttacag--gctagctcaggact-
A0A2K5NZS5_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtggg---------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
A0A2K5MMZ4_BCL2L10      ----acccgttgcgggagcgcaccga---gcggctcctgg---ccgact-
A0A2K5LXU8_MCL1-01      -----------tttggcctcaaaagaaacgcggtaatcggactcaacct-
A0A2K5LXU8_MCL1-03      -----------tttggcctcaaaagaaacgcggtaatcggactcaacct-
A0A2K5MZX9_BCL2L2-      ----ccccagcctcggcccc---agacacacgggctctggtggcagact-
A0A2K5MZX9_BCL2L2-      ----ccccagcctcggcccc---agacacacgggctctggtggcagact-
                                                                          

A0A2K5KHH8_BCL2A1-      ---atttgcagtacgttct-gcagataccacaacctggatcgggtccaag
A0A2K5KHH8_BCL2A1-      ---atttgcagtacgttct-gcagataccacaacctggatcgggtccaag
A0A2K5NZS5_BCL2-01      ---atgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccg
A0A2K5M8B1_BCL2L1-      ---atgtggaagagaacaggactgaggccccagaagggactgaatc----
A0A2K5M8B1_BCL2L1-      gtgatgtggaagagaacaggactgaggccccagaagggactgaatc----
A0A2K5MMZ4_BCL2L10      ---atctggggt--------gctgcgccc----gggaacc----------
A0A2K5LXU8_MCL1-01      ---ctactgtgggggg----gccg-gctt----gggggccggcagc----
A0A2K5LXU8_MCL1-03      ---ctactgtgggggg----gccg-gctt----gggggccggcagc----
A0A2K5MZX9_BCL2L2-      ---ttgtaggttataa----gctgaggca----gaagggttatgtc----
A0A2K5MZX9_BCL2L2-      ---ttgtaggttataa----gctgaggca----gaagggttatgtc----
                            *                * *                          

A0A2K5KHH8_BCL2A1-      caaaacg----tccagagtgctacaaaaggt-------------------
A0A2K5KHH8_BCL2A1-      caaaacg----tccagagtgctacaaaaggt-------------------
A0A2K5NZS5_BCL2-01      ggcatcttctcctcccagcc------cgggc-------------------
A0A2K5M8B1_BCL2L1-      ggagatggagacccccagtgccatcaatggc-------------------
A0A2K5M8B1_BCL2L1-      ggagatggagacccccagtgccatcaatggc-------------------
A0A2K5MMZ4_BCL2L10      -----cggcacccctgagcc------gaggc-------------------
A0A2K5LXU8_MCL1-01      ggcggcgccacccctccggg------agggcggcttttggctacggagaa
A0A2K5LXU8_MCL1-03      ggcggcgccacccctccggg------agggcggctttt------------
A0A2K5MZX9_BCL2L2-      tgtggagctggccct-gggg------agggc-------------------
A0A2K5MZX9_BCL2L2-      tgtggagctggccct-gggg------agggc-------------------
                                     *   *          **                    

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ggaggcctcggcccggcgagagatagggggaggggaggccggcacggtga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ttggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      cggagggtcgcgcggccgccgcccattggcgcggaggtccccgacgtcac
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      cgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      cgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaa
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      gaggagctggacgggtacgagccggagcctctcgggaagcggccggctgt
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      cctgcccctgctggagttggtcggggaatctggtaatagccccagtacgg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      atgggtcactaccctcgacgccgccgccagcagaggaggaggaggacgag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      ---------------------------acacgccccatcccgccgcgtcc
A0A2K5M8B1_BCL2L1-      ----------------------------------------------aacc
A0A2K5M8B1_BCL2L1-      ----------------------------------------------aacc
A0A2K5MMZ4_BCL2L10      -----------------------------------------cgtccacgc
A0A2K5LXU8_MCL1-01      ttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
A0A2K5LXU8_MCL1-03      -----------------------------------------------ggc
A0A2K5MZX9_BCL2L2-      -------------------------------------------------c
A0A2K5MZX9_BCL2L2-      -------------------------------------------------c
                                                                          

A0A2K5KHH8_BCL2A1-      ------tgcattctcagtccaaaaagaagtggaaaa--------------
A0A2K5KHH8_BCL2A1-      ------tgcattctcagtccaaaaagaagtggaaaa--------------
A0A2K5NZS5_BCL2-01      cgggacccggtcgccaggacctcgcc--gctgccga--ccccggctgccc
A0A2K5M8B1_BCL2L1-      catc--ct------------------------------------------
A0A2K5M8B1_BCL2L1-      catc--ctggcacctggtggacagccccgcggtgaatggagccactggcc
A0A2K5MMZ4_BCL2L10      ccgaggccgccgtgctgcgctcagca--gccgccag--------------
A0A2K5LXU8_MCL1-01      caccggc--gccaaggacacaaagcca-atgggcaggtctggggccacca
A0A2K5LXU8_MCL1-03      caccggc--gccaaggacacaaagcca-atgggcaggtctggggccacca
A0A2K5MZX9_BCL2L2-      cagcagctgacccgctgcaccaagccatgcgggcag--------------
A0A2K5MZX9_BCL2L2-      cagcagctgacccgctgcaccaagccatgcgggcag--------------
                                                                          

A0A2K5KHH8_BCL2A1-      -------gaatctgaa----------------------------------
A0A2K5KHH8_BCL2A1-      -------gaatctgaa----------------------------------
A0A2K5NZS5_BCL2-01      ccgccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccac
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      acagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaag
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      gcaggaaggctctggagacct-----------------------------
A0A2K5LXU8_MCL1-03      gcaggaaggctctggagacct-----------------------------
A0A2K5MZX9_BCL2L2-      -----------ctgga----------------------------------
A0A2K5MZX9_BCL2L2-      -----------ctgga----------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ---------------------gccatgcttggacaatgttaatgttgcat
A0A2K5KHH8_BCL2A1-      ---------------------gccatgcttggacaatgttaatgttgcat
A0A2K5NZS5_BCL2-01      ctgaccctccgccaggccggtgacgacttctcccgccgctaccgccgcga
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      caagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggc
A0A2K5MMZ4_BCL2L10      --------------------------gttacggcagctccaccggtcctt
A0A2K5LXU8_MCL1-01      ------------------tacgacgggttgggga-tggcgtgcagcgcaa
A0A2K5LXU8_MCL1-03      ------------------tacgacgggttgggga-tggcgtgcagcgcaa
A0A2K5MZX9_BCL2L2-      ---------------------gatgagttcgagacccgcttccggcgcac
A0A2K5MZX9_BCL2L2-      ---------------------gatgagttcgagacccgcttccggcgcac
                                                                          

A0A2K5KHH8_BCL2A1-      ----------------------------------ccatagacactgccag
A0A2K5KHH8_BCL2A1-      ----------------------------------ccatagacactgccag
A0A2K5NZS5_BCL2-01      cttcgccgagatgtc--cagccagctgcacctgacgcccttcaccgcgcg
A0A2K5M8B1_BCL2L1-      ---------------------------------------gggacagcata
A0A2K5M8B1_BCL2L1-      gttcagtgacctgacatc--ccagctccacatcaccccagggacagcata
A0A2K5MMZ4_BCL2L10      cttctcc---------gcctaccgcggc----taccgcgggaaccg----
A0A2K5LXU8_MCL1-01      cc------acgagacggccttccaaggcatg---cttcggaaactggaca
A0A2K5LXU8_MCL1-03      cc------acgagacggccttccaaggcatg---cttcggaaactggaca
A0A2K5MZX9_BCL2L2-      cttctctgatctggcggc--tcagctgcatgtgaccccaggctcagcaca
A0A2K5MZX9_BCL2L2-      cttctctgatctggcggc--tcagctgcatgtgaccccaggctcagcaca
                                                                   * *    

A0A2K5KHH8_BCL2A1-      aac------------actattcaatcaagtgatggaaaa----------g
A0A2K5KHH8_BCL2A1-      aac------------actattcaatcaagtgatggaaaa----------g
A0A2K5NZS5_BCL2-01      ggg------------acgctttgccacggtggtggagga----------g
A0A2K5M8B1_BCL2L1-      tca------------gagctttgaacaggtagtgaatga------act--
A0A2K5M8B1_BCL2L1-      tca------------gagctttgaacaggtagtgaatga------act--
A0A2K5MMZ4_BCL2L10      ----------------cgtcgagctggtggcgctgatggcggaggccgtg
A0A2K5LXU8_MCL1-01      tcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatg--
A0A2K5LXU8_MCL1-03      tcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatg--
A0A2K5MZX9_BCL2L2-      gca------------acgcttcacccaggtctccgatga------act--
A0A2K5MZX9_BCL2L2-      gca------------acgcttcacccaggtctccgatga------act--
                                                    *                     

A0A2K5KHH8_BCL2A1-      gaatttgaagatggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KHH8_BCL2A1-      gaatttgaagatggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5NZS5_BCL2-01      ctcttcagggacgggg---tgaactgggggaggatcgtggccttctttga
A0A2K5M8B1_BCL2L1-      -cttccgggatgggg----tgaactggggtcgcattgtggcctttttctc
A0A2K5M8B1_BCL2L1-      -cttccgggatgggg----tgaactggggtcgcattgtggcctttttctc
A0A2K5MMZ4_BCL2L10      ctctccgacagccccggccccacctggggcagggtggtgtcgctggtgac
A0A2K5LXU8_MCL1-01      -ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttc
A0A2K5LXU8_MCL1-03      -ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttc
A0A2K5MZX9_BCL2L2-      -tttccaagggggcc----ccaactggggccgccttgtagccttctttgt
A0A2K5MZX9_BCL2L2-      -tttccaagggggcc----ccaactggggccgccttgtagccttctttgt
                           *                 * ******  *  * **  *  *  *   

A0A2K5KHH8_BCL2A1-      atttgaaggtattctcatcaagaaacttctacgacagcgaattgccccgg
A0A2K5KHH8_BCL2A1-      atttgaaggtattctcatcaagaaacttctacgacagcgaattgccccgg
A0A2K5NZS5_BCL2-01      gttcggtggggtcatgtgtg----------tggagagcg--tcaaccggg
A0A2K5M8B1_BCL2L1-      cttcggcggggcactgtgcg----------tggaaagcg--tagacaagg
A0A2K5M8B1_BCL2L1-      cttcggcggggcactgtgcg----------tggaaagcg--tagacaagg
A0A2K5MMZ4_BCL2L10      cttcgcggggacgctgctgg-----------agagagag--ccgctggtg
A0A2K5LXU8_MCL1-01      ttttggtgc----ctttgtggctaaacacttgaagacca--taaaccaag
A0A2K5LXU8_MCL1-03      ttttggtgc----ctttgtggctaaacacttgaagacca--taaaccaag
A0A2K5MZX9_BCL2L2-      ctttggggctgcactgtgtg----------ctgagagtg--tcaacaagg
A0A2K5MZX9_BCL2L2-      ctttggggctgcactgtgtg----------ctgagagtg--tcaacaagg
                         ** *  *      *                  * *             *

A0A2K5KHH8_BCL2A1-      at------gtgga-------------tacttataaggagatttcgta---
A0A2K5KHH8_BCL2A1-      at------gtgga-------------tacttataaggagatttcgta---
A0A2K5NZS5_BCL2-01      ag------atgtcg------------cccctggtggacaacatcgccc--
A0A2K5M8B1_BCL2L1-      ag------atgcag------------gtattggtgagtcggatcgcag--
A0A2K5M8B1_BCL2L1-      ag------atgcag------------gtattggtgagtcggatcgcag--
A0A2K5MMZ4_BCL2L10      acagcctggtggaagaagcggggcttccagccgcggctgaaggagcagga
A0A2K5LXU8_MCL1-01      aaagctgcatcgaa------------ccattagcagaaagtatcacaga-
A0A2K5LXU8_MCL1-03      aaagctgcatcgaa------------ccattagcagaaagtatcacaga-
A0A2K5MZX9_BCL2L2-      ag------atggaa------------ccactggtgggaca-agtgcagg-
A0A2K5MZX9_BCL2L2-      ag------atggaa------------ccactggtgggaca-agtgcagg-
                        *        *                                        

A0A2K5KHH8_BCL2A1-      -----------------------ttttgttgctgagttcataatgaataa
A0A2K5KHH8_BCL2A1-      -----------------------ttttgttgctgagttcataatgaataa
A0A2K5NZS5_BCL2-01      -----------------------tgtggatgactgagtacctgaaccggc
A0A2K5M8B1_BCL2L1-      -----------------------cttggatggccacttacctgaa----t
A0A2K5M8B1_BCL2L1-      -----------------------cttggatggccacttacctgaa----t
A0A2K5MMZ4_BCL2L10      gggcgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgc
A0A2K5LXU8_MCL1-01      -----------------------cgttctcgtaaggaca-----aaacgg
A0A2K5LXU8_MCL1-03      -----------------------cgttctcgtaaggaca-----aaacgg
A0A2K5MZX9_BCL2L2-      -----------------------agtggatggtggcctacctggagacgc
A0A2K5MZX9_BCL2L2-      -----------------------agtggatggtggcctacctggagacgc
                                                      *                   

A0A2K5KHH8_BCL2A1-      cacaggagaa-------------tggataaggcaaaacggaggctggg--
A0A2K5KHH8_BCL2A1-      cacaggagaa-------------tggataaggcaaaacggaggctggg--
A0A2K5NZS5_BCL2-01      acctgcacac------------ctggatccaggataacggaggctggg--
A0A2K5M8B1_BCL2L1-      gaccacctag--------agccttggatccaggagaacggcggctggg--
A0A2K5M8B1_BCL2L1-      gaccacctag--------agccttggatccaggagaacggcggctggg--
A0A2K5MMZ4_BCL2L10      ggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctggg--
A0A2K5LXU8_MCL1-01      gactggctag------------ttaaacaaa--------gaggctggg--
A0A2K5LXU8_MCL1-03      gactggctag------------ttaaacaaa--------gaggctggg--
A0A2K5MZX9_BCL2L2-      ggctggctga------------ctggatccacagcagtgggggctgggag
A0A2K5MZX9_BCL2L2-      ggctggctga------------ctggatccacagcagtgggggctgggcg
                          *                    *               * *******  

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5MZX9_BCL2L2-      ------gagttcacagctctatacgggg----------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------aaaatggct---------------------------
A0A2K5KHH8_BCL2A1-      --------------aaaatggct---------------------------
A0A2K5NZS5_BCL2-01      -----------------acgcct---------------------------
A0A2K5M8B1_BCL2L1-      -----------------acactt---------------------------
A0A2K5M8B1_BCL2L1-      -----------------acactt---------------------------
A0A2K5MMZ4_BCL2L10      -----------------atggct---------------------------
A0A2K5LXU8_MCL1-01      -----------------atgggt---------------------------
A0A2K5LXU8_MCL1-03      -----------------atgggt---------------------------
A0A2K5MZX9_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5MZX9_BCL2L2-      -----------------acgggg---------------------------
                                         *                                

A0A2K5KHH8_BCL2A1-      ---------------------------------ttgtaaagaa-------
A0A2K5KHH8_BCL2A1-      ---------------------------------ttgtaaagaa-------
A0A2K5NZS5_BCL2-01      ---------------------------------ttgtggaa---------
A0A2K5M8B1_BCL2L1-      ---------------------------------ttgtggaa---------
A0A2K5M8B1_BCL2L1-      ---------------------------------ttgtggaa---------
A0A2K5MMZ4_BCL2L10      ----------------------tttgtcacttcttcaggag---------
A0A2K5LXU8_MCL1-01      ---------------------------------ttgtggag---------
A0A2K5LXU8_MCL1-03      ---------------------------------ttgtggag---------
A0A2K5MZX9_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5MZX9_BCL2L2-      ------------------------------ccctggaggaggcg-cggcg
                                                         *     *          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      ---------------ctgtacg----------------------------
A0A2K5M8B1_BCL2L1-      ---------------ctctatgggaacaatgcag------------cagc
A0A2K5M8B1_BCL2L1-      ---------------ctctatgggaacaatgcag------------cagc
A0A2K5MMZ4_BCL2L10      ------------cccctttccgctg-------------------------
A0A2K5LXU8_MCL1-01      ------------ttcttccatgt---------------------------
A0A2K5LXU8_MCL1-03      ------------ttcttccatgt---------------------------
A0A2K5MZX9_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5MZX9_BCL2L2-      tctg------------------------------------------cggg
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      cgagagccgaaagggccaggagc---------------------------
A0A2K5M8B1_BCL2L1-      cgagagccgaaagggccaggagc---------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      agaggacctagaaggtg---------------------------------
A0A2K5LXU8_MCL1-03      agaggacctagaaggtg---------------------------------
A0A2K5MZX9_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5MZX9_BCL2L2-      aggggaactgg---------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ---------------gcttgagcctaaat---------------------
A0A2K5KHH8_BCL2A1-      ---------------gtttgaacctaaat---------------------
A0A2K5NZS5_BCL2-01      ---------------gccccagca--------------------------
A0A2K5M8B1_BCL2L1-      ---------------gcttca-----------------------------
A0A2K5M8B1_BCL2L1-      ---------------gcttca-----------------------------
A0A2K5MMZ4_BCL2L10      ---------------gctttttggagaac---------------------
A0A2K5LXU8_MCL1-01      ---------------gcatcagaaa-------------------------
A0A2K5LXU8_MCL1-03      ---------------gcatcagaaa-------------------------
A0A2K5MZX9_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
A0A2K5MZX9_BCL2L2-      ---------------gcatcagtgaggac---------------------
                                       *                                  

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      ------------------------tgcggcct------------------
A0A2K5M8B1_BCL2L1-      ------------------------accg----------------------
A0A2K5M8B1_BCL2L1-      ------------------------accg----------------------
A0A2K5MMZ4_BCL2L10      ------------------------actg----------------------
A0A2K5LXU8_MCL1-01      ------------------------tgtg----------------------
A0A2K5LXU8_MCL1-03      ------------------------tgtg----------------------
A0A2K5MZX9_BCL2L2-      cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagac
A0A2K5MZX9_BCL2L2-      ------------------------agtg----------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ---------------ctggctgga--------------------------
A0A2K5KHH8_BCL2A1-      ---------------ctggctgga--------------------------
A0A2K5NZS5_BCL2-01      ---------------ctgtttgatttctcc--------------------
A0A2K5M8B1_BCL2L1-      ---------------ctggttcc---------------------------
A0A2K5M8B1_BCL2L1-      ---------------ctggttcc---------------------------
A0A2K5MMZ4_BCL2L10      ---------------ctgatccaggctttcc-------------------
A0A2K5LXU8_MCL1-01      ---------------ctgc-------------------------------
A0A2K5LXU8_MCL1-03      ---------------ctgc-------------------------------
A0A2K5MZX9_BCL2L2-      caggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcc
A0A2K5MZX9_BCL2L2-      ---------------ctgacggggg-------------------------
                                       * *                                

A0A2K5KHH8_BCL2A1-      -----------------------------------------tgac-----
A0A2K5KHH8_BCL2A1-      -----------------------------------------tgac-----
A0A2K5NZS5_BCL2-01      -----------------------------------------tggc-----
A0A2K5M8B1_BCL2L1-      -----------------------------------------tgac-----
A0A2K5M8B1_BCL2L1-      -----------------------------------------tgac-----
A0A2K5MMZ4_BCL2L10      -----------------------------------------tggcatgct
A0A2K5LXU8_MCL1-01      -----------------------------------------tggc-----
A0A2K5LXU8_MCL1-03      -----------------------------------------tggc-----
A0A2K5MZX9_BCL2L2-      cggaccaccaactacaacagttcccgctctcgattctacagtggt-----
A0A2K5MZX9_BCL2L2-      --------------------------------------ccgtggc-----
                                                                 **       

A0A2K5KHH8_BCL2A1-      -ttttctagaagttacaggaaagat----ctgtgaaatgc----------
A0A2K5KHH8_BCL2A1-      -ttttctagaagttacaggaaagat----ctgtgaaatgc----------
A0A2K5NZS5_BCL2-01      -tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcac
A0A2K5M8B1_BCL2L1-      -gggcatgactgtggccggcgtggttctgctgggctcac-----------
A0A2K5M8B1_BCL2L1-      -gggcatgactgtggccggcgtggttctgctgggctcac-----------
A0A2K5MMZ4_BCL2L10      tgttagcaacagccttcg--gttat--ctctggacacgat----------
A0A2K5LXU8_MCL1-01      -tgttgcaggtgttgctggagtagg--agctggtttggca----------
A0A2K5LXU8_MCL1-03      -tgttgcaggtgttgctggagtagg--agctggtttggca----------
A0A2K5MZX9_BCL2L2-      -tttaacagcaggccccggggtcgt--gtctacaggggccgggctagagc
A0A2K5MZX9_BCL2L2-      -----actgggggccctg-----gt--aactgtaggggcc----------
                                   *     *           *                    

A0A2K5KHH8_BCL2A1-      ----------tctctcttctgaagcaatactgttga
A0A2K5KHH8_BCL2A1-      ----------tatctctcctgaagcaatactgttga
A0A2K5NZS5_BCL2-01      cctgggtgcctatctgggccacaa-------g-tga
A0A2K5M8B1_BCL2L1-      ----------tcttcagtcggaaa---------tga
A0A2K5M8B1_BCL2L1-      ----------tcttcagtcggaaa---------tga
A0A2K5MMZ4_BCL2L10      ----------tatta------------------tga
A0A2K5LXU8_MCL1-01      ----------tat----ctaataa-------gatag
A0A2K5LXU8_MCL1-03      ----------tat----ctaataa-------gatag
A0A2K5MZX9_BCL2L2-      gacatcatggtattccccttac-----------taa
A0A2K5MZX9_BCL2L2-      ----------ttttttgctagcaa-------g-tga
                                  * *                    *  

© 1998-2020Legal notice