Dataset for CDS BCL-2-like of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ------------------atgtctcagagcaaccgggagctggtggttga
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      gtacatccactataagctgtcgcagaggggct------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ---atg-acagactgtgaatttggatatatttacaggctagctcaggact
A0A2K5KHH8_BCL2A1-      ---atg-acagactgtgaatttggatatatttacaggctagctcaggact
A0A2K5KHH8_BCL2A1-      ---atg-acagactgtgaatttggatatatttacaggctagctcaggact
A0A2K5NZS5_BCL2-01      ---acgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcc
A0A2K5MMZ4_BCL2L10      ---atggctgacccgttgcgggagcgcaccgagcgg-ctcctggccgact
A0A2K5LXU8_MCL1-02      ---atgtttggcct-caaaagaaacgcggtaatcggactcaacctctact
A0A2K5LXU8_MCL1-01      ---atgtttggcct-caaaagaaacgcggtaatcggactcaacctctact
A0A2K5LXU8_MCL1-03      ---atgtttggcct-caaaagaaacgcggtaatcggactcaacctctact
A0A2K5M8B1_BCL2L1-      gtgatg---------tggaagagaacaggactgaggccccagaagggact
A0A2K5M8B1_BCL2L1-      ---atg---------tggaagagaacaggactgaggccccagaagggact
A0A2K5MZX9_BCL2L2-      ---atg--------------gcggcggcggcggcggcggcagcagcagcg
A0A2K5MZX9_BCL2L2-      ---atg--------------gcggcggcggcggcggcggcagcagcagcg
A0A2K5MZX9_BCL2L2-      ---atg--------------gcgaccccagcctcggccccagacaca-cg
A0A2K5MZX9_BCL2L2-      ---atg--------------gcgaccccagcctcggccccagacaca-cg
                           * *                                          * 

A0A2K5KHH8_BCL2A1-      attt-gcagtacgttctgcagataccacaacctggatcggg---------
A0A2K5KHH8_BCL2A1-      attt-gcagtacgttctgcagataccacaacctggatcggg---------
A0A2K5KHH8_BCL2A1-      attt-gcagtacgttctgcagataccacaacctggatcggg---------
A0A2K5NZS5_BCL2-01      cccgcaccgggcatcttctc----ctcccagcccgggcacacgccccatc
A0A2K5MMZ4_BCL2L10      atct-ggggtgctgcgcccgggaacc-----------cggca-------c
A0A2K5LXU8_MCL1-02      gt-g-ggggggccg-gcttgggggccggcagcggcggcgcca-------c
A0A2K5LXU8_MCL1-01      gt-g-ggggggccg-gcttgggggccggcagcggcggcgcca-------c
A0A2K5LXU8_MCL1-03      gt-g-ggggggccg-gcttgggggccggcagcggcggcgcca-------c
A0A2K5M8B1_BCL2L1-      gaatcggaga--------tggagacccccagt---gccatcaatggcaac
A0A2K5M8B1_BCL2L1-      gaatcggaga--------tggagacccccagt---gccatcaatggcaac
A0A2K5MZX9_BCL2L2-      ggggctgcgggcggtc----ggggctccgggccggggcggcggcgccatc
A0A2K5MZX9_BCL2L2-      ggggctgcgggcggtc----ggggctccgggccggggcggcggcgccatc
A0A2K5MZX9_BCL2L2-      ggctctggtggcagactttgtaggttataagctgaggcagaagggtta--
A0A2K5MZX9_BCL2L2-      ggctctggtggcagactttgtaggttataagctgaggcagaagggtta--
                                                             *            

A0A2K5KHH8_BCL2A1-      --------tccaagcaaaacgt--ccagagtgctacaa------------
A0A2K5KHH8_BCL2A1-      --------tccaagcaaaacgt--ccagagtgctacaa------------
A0A2K5KHH8_BCL2A1-      --------tccaagcaaaacgt--ccagagtgctacaa------------
A0A2K5NZS5_BCL2-01      ccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccg
A0A2K5MMZ4_BCL2L10      ccc-----tgagccgaggccgt--ccacgccc------------------
A0A2K5LXU8_MCL1-02      ccc-----tccgggagggcggc--ttttggctacggagaaggaggcctcg
A0A2K5LXU8_MCL1-01      ccc-----tccgggagggcggc--ttttggctacggagaaggaggcctcg
A0A2K5LXU8_MCL1-03      ccc-----tccgggagggcggc--tttt----------------------
A0A2K5M8B1_BCL2L1-      cca-----tcctggcacctggt--ggacagccccgcggtgaatggagcca
A0A2K5M8B1_BCL2L1-      cca-----tcct--------------------------------------
A0A2K5MZX9_BCL2L2-      ttg-----tgcccggggccggt------gg--------------------
A0A2K5MZX9_BCL2L2-      ttg-----tgcccggggccggt------gg--------------------
A0A2K5MZX9_BCL2L2-      -tg-----tctgtggagctggc--cctggg--------------------
A0A2K5MZX9_BCL2L2-      -tg-----tctgtggagctggc--cctggg--------------------
                                *                                         

A0A2K5KHH8_BCL2A1-      ------------------------aaggttgcattctcagtccaaaaaga
A0A2K5KHH8_BCL2A1-      ------------------------aaggttgcattctcagtccaaaaaga
A0A2K5KHH8_BCL2A1-      ------------------------aaggttgcattctcagtccaaaaaga
A0A2K5NZS5_BCL2-01      ------------------------gctgcccccgccgccgccgcggggcc
A0A2K5MMZ4_BCL2L10      ------------------------gaggccgccgtgctg-----------
A0A2K5LXU8_MCL1-02      gcccggcgagagatagggggaggggaggccggcacggtgattggcggaag
A0A2K5LXU8_MCL1-01      gcccggcgagagatagggggaggggaggccggcacggtgattggcggaag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ctggccacagcagcagtttg----gatgcccgggaggtgatccccatggc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      -------------------g----gaggccggggagggggccccgggggg
A0A2K5MZX9_BCL2L2-      -------------------g----gaggccggggagggggccccgggggg
A0A2K5MZX9_BCL2L2-      -------------------g----agggcccagcagctgaccc-----gc
A0A2K5MZX9_BCL2L2-      -------------------g----agggcccagcagctgaccc-----gc
                                                                          

A0A2K5KHH8_BCL2A1-      agtgga------------------------------------------aa
A0A2K5KHH8_BCL2A1-      agtgga------------------------------------------aa
A0A2K5KHH8_BCL2A1-      agtgga------------------------------------------aa
A0A2K5NZS5_BCL2-01      tgcgctcagcccggtgccacctgtggtccacctgaccctc--------cg
A0A2K5MMZ4_BCL2L10      ------------------------------------------------cg
A0A2K5LXU8_MCL1-02      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      agcagtaaagcaagcgctg-----------------------------ag
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      cgcaggggacta-----cg-----------------------------gg
A0A2K5MZX9_BCL2L2-      cgcaggggacta-----cg-----------------------------gg
A0A2K5MZX9_BCL2L2-      tgcaccaagcca-----tg-----------------------------cg
A0A2K5MZX9_BCL2L2-      tgcaccaagcca-----tg-----------------------------cg
                                                                          

A0A2K5KHH8_BCL2A1-      agaatctgaagcc--------------------atgcttggacaatgtta
A0A2K5KHH8_BCL2A1-      agaatctgaagcc--------------------atgcttggacaatgtta
A0A2K5KHH8_BCL2A1-      agaatctgaagcc--------------------atgcttggacaatgtta
A0A2K5NZS5_BCL2-01      ccaggccggtgac--------------------gacttctcccgccgcta
A0A2K5MMZ4_BCL2L10      ctcagcagccgcc--------------------aggttacggcagctcca
A0A2K5LXU8_MCL1-02      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccccc
A0A2K5LXU8_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccccc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ggaggcaggcgac--------------------gagtttgaactgcggta
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      aacggcctg------------------------gagtctgag--------
A0A2K5MZX9_BCL2L2-      aacggcctg------------------------gagtctgag--------
A0A2K5MZX9_BCL2L2-      ggcagctggagat--------------------gagttcgagacccgctt
A0A2K5MZX9_BCL2L2-      ggcagctggagat--------------------gagttcgagacccgctt
                                                                          

A0A2K5KHH8_BCL2A1-      atgttgca------------------------------------------
A0A2K5KHH8_BCL2A1-      atgttgca------------------------------------------
A0A2K5KHH8_BCL2A1-      atgttgca------------------------------------------
A0A2K5NZS5_BCL2-01      ccgccgcgacttcgccgagatgtccagccagctgcacctg----------
A0A2K5MMZ4_BCL2L10      ccggtccttcttctc----cgccta-------------------------
A0A2K5LXU8_MCL1-02      gcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagga
A0A2K5LXU8_MCL1-01      gcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgagga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatc----------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ----------------gaactggagcctgaggagctgctgctggagcccg
A0A2K5MZX9_BCL2L2-      ----------------gaactggagcctgagga-----------------
A0A2K5MZX9_BCL2L2-      ccggcgcaccttctctgatctggcggctcagctgcatgtg----------
A0A2K5MZX9_BCL2L2-      ccggcgcaccttctctgatctggcggctcagctgcatgtg----------
                                                                          

A0A2K5KHH8_BCL2A1-      -tccatagacactgccagaacactattcaatcaagtgatggaaaaggaat
A0A2K5KHH8_BCL2A1-      -tccatagacactgccagaacactattcaatcaagtgatggaaaaggaat
A0A2K5KHH8_BCL2A1-      -tccatagacactgccagaacactattcaatcaagtgatggaaaaggaat
A0A2K5NZS5_BCL2-01      -acgcccttcaccgcgcggggacgctttgccacggtggtggaggagctct
A0A2K5MMZ4_BCL2L10      --------ccgcggctaccgcgggaaccgcgtc----------gagctgg
A0A2K5LXU8_MCL1-02      gatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctgg
A0A2K5LXU8_MCL1-01      gatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctgg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -accccagggacagcatatcagagctttgaacaggtagtgaatgaactct
A0A2K5M8B1_BCL2L1-      -------gggacagcatatcagagctttgaacaggtagtgaatgaactct
A0A2K5MZX9_BCL2L2-      agccggagcccgagcccgaagaggagccgccccggcccc------gcgcc
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      -accccaggctcagcacagcaacgcttcacccaggtctccgatgaacttt
A0A2K5MZX9_BCL2L2-      -accccaggctcagcacagcaacgcttcacccaggtctccgatgaacttt
                                                                          

A0A2K5KHH8_BCL2A1-      ttgaagatggcatcat---taactggggaagaattgtaaccatatttgca
A0A2K5KHH8_BCL2A1-      ttgaagatggcatcat---taactggggaagaattgtaaccatatttgca
A0A2K5KHH8_BCL2A1-      ttgaagatggcatcat---taactggggaagaattgtaaccatatttgca
A0A2K5NZS5_BCL2-01      tcagggacggggtgaa------ctgggggaggatcgtggccttctttgag
A0A2K5MMZ4_BCL2L10      ------------------------------------------tggcgctg
A0A2K5LXU8_MCL1-02      acgggtacgagccggagcctctcgggaagcggccggctgtcctgcccctg
A0A2K5LXU8_MCL1-01      acgggtacgagccggagcctctcgggaagcggccggctgtcctgcccctg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      tccgggatggggtgaa------ctggggtcgcattgtggcctttttctcc
A0A2K5M8B1_BCL2L1-      tccgggatggggtgaa------ctggggtcgcattgtggcctttttctcc
A0A2K5MZX9_BCL2L2-      cccccgggagctccg----------------------ggccctgggcctg
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      tccaagggggccccaa------ctggggccgccttgtagccttctttgtc
A0A2K5MZX9_BCL2L2-      tccaagggggccccaa------ctggggccgccttgtagccttctttgtc
                                                                          

A0A2K5KHH8_BCL2A1-      tttgaaggtattct---catcaagaa------------------------
A0A2K5KHH8_BCL2A1-      tttgaaggtattct---catcaagaa------------------------
A0A2K5KHH8_BCL2A1-      tttgaaggtattct---catcaagaa------------------------
A0A2K5NZS5_BCL2-01      ttcggtggggtcatgtgtgtggagag------------------------
A0A2K5MMZ4_BCL2L10      atggcggaggccgtgctctccgacag------------------------
A0A2K5LXU8_MCL1-02      ctggagttggtcggggaatctggtaatagccccagtacggatgggtcact
A0A2K5LXU8_MCL1-01      ctggagttggtcggggaatctggtaatagccccagtacggatgggtcact
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ttcggcggggcactgtgcgtggaaag------------------------
A0A2K5M8B1_BCL2L1-      ttcggcggggcactgtgcgtggaaag------------------------
A0A2K5MZX9_BCL2L2-      gttcgggagcccccggcagccaagag------------------------
A0A2K5MZX9_BCL2L2-      -------------------ccaagag------------------------
A0A2K5MZX9_BCL2L2-      tttggggctgcactgtgtgctgagag------------------------
A0A2K5MZX9_BCL2L2-      tttggggctgcactgtgtgctgagag------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ----------acttctacgacagcgaattgccc-----------------
A0A2K5KHH8_BCL2A1-      ----------acttctacgacagcgaattgccc-----------------
A0A2K5KHH8_BCL2A1-      ----------acttctacgacagcgaattgccc-----------------
A0A2K5NZS5_BCL2-01      --------------cgtcaaccgggagatgtcgcccctggtggacaacat
A0A2K5MMZ4_BCL2L10      --ccccggccccacctggggcagggtgg----------------------
A0A2K5LXU8_MCL1-02      accctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggc
A0A2K5LXU8_MCL1-01      accctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------cgtagacaaggagatgcaggtattggtgagtcggat
A0A2K5M8B1_BCL2L1-      --------------cgtagacaaggagatgcaggtattggtgagtcggat
A0A2K5MZX9_BCL2L2-      ---------------------gaggaggaggagcc------gggac----
A0A2K5MZX9_BCL2L2-      ---------------------gaggaggaggagcc------gggac----
A0A2K5MZX9_BCL2L2-      --------------tgtcaacaaggagatggaaccactggtgggacaagt
A0A2K5MZX9_BCL2L2-      --------------tgtcaacaaggagatggaaccactggtgggacaagt
                                                                          

A0A2K5KHH8_BCL2A1-      -------------cggatgtggatacttataaggagatttcgtattttgt
A0A2K5KHH8_BCL2A1-      -------------cggatgtggatacttataaggagatttcgtattttgt
A0A2K5KHH8_BCL2A1-      -------------cggatgtggatacttataaggagatttcgtattttgt
A0A2K5NZS5_BCL2-01      cgccc--------tgtggatgactgagtacctgaacc---ggcacctgca
A0A2K5MMZ4_BCL2L10      -------------tgtcgctggtgaccttcgcgggga---cgctgctgga
A0A2K5LXU8_MCL1-02      agtcgctggagattatctctcggtaccttcgggagca---ggccaccggc
A0A2K5LXU8_MCL1-01      agtcgctggagattatctctcggtaccttcgggagca---ggccaccggc
A0A2K5LXU8_MCL1-03      ----------------------------------------ggccaccggc
A0A2K5M8B1_BCL2L1-      cgcag--------cttggatggccacttacctg-----------------
A0A2K5M8B1_BCL2L1-      cgcag--------cttggatggccacttacctg-----------------
A0A2K5MZX9_BCL2L2-      ----t--------ggtcgagggtgac---ccggggga---cggcgc----
A0A2K5MZX9_BCL2L2-      ----t--------ggtcgagggtgac---ccggggga---cggcgc----
A0A2K5MZX9_BCL2L2-      gcagg--------agtggatggtggcctacctggaga---cgcggctggc
A0A2K5MZX9_BCL2L2-      gcagg--------agtggatggtggcctacctggaga---cgcggctggc
                                                                          

A0A2K5KHH8_BCL2A1-      tgctgagttcataatgaataacacaggagaa-------------------
A0A2K5KHH8_BCL2A1-      tgctgagttcataatgaataacacaggagaa-------------------
A0A2K5KHH8_BCL2A1-      tgctgagttcataatgaataacacaggagaa-------------------
A0A2K5NZS5_BCL2-01      cacctggatcc---------------------------------------
A0A2K5MMZ4_BCL2L10      gagagagccgctggtgacagcctggtggaagaagcggggcttccagccgc
A0A2K5LXU8_MCL1-02      gccaaggacac-----aaagccaatgggcaggtctggggccaccagcag-
A0A2K5LXU8_MCL1-01      gccaaggacac-----aaagccaatgggcaggtctggggccaccagcag-
A0A2K5LXU8_MCL1-03      gccaaggacac-----aaagccaatgggcaggtctggggccaccagcag-
A0A2K5M8B1_BCL2L1-      ----------------aatgaccacctagagc---------------ctt
A0A2K5M8B1_BCL2L1-      ----------------aatgaccacctagagc---------------ctt
A0A2K5MZX9_BCL2L2-      ---------------cattgaggacccggagctggaagctatcaaagctc
A0A2K5MZX9_BCL2L2-      ---------------cattgaggacccggagctggaagctatcaaagctc
A0A2K5MZX9_BCL2L2-      tgactggatccacagcagtgggggctgggagctggaagctatcaaagctc
A0A2K5MZX9_BCL2L2-      tgactggatccacagcagtgggggctgggcg------gagttcacagctc
                                                                          

A0A2K5KHH8_BCL2A1-      ---------------------------------------------tggat
A0A2K5KHH8_BCL2A1-      ---------------------------------------------tggat
A0A2K5KHH8_BCL2A1-      ---------------------------------------------tggat
A0A2K5NZS5_BCL2-01      ---------------------------------------------aggat
A0A2K5MMZ4_BCL2L10      ggctgaaggagcag------------gag---------------ggcgac
A0A2K5LXU8_MCL1-02      ----gaaggctctg------------gagaccttacgacgggttggggat
A0A2K5LXU8_MCL1-01      ----gaaggctctg------------gagaccttacgacgggttggggat
A0A2K5LXU8_MCL1-03      ----gaaggctctg------------gagaccttacgacgggttggggat
A0A2K5M8B1_BCL2L1-      ggatccagg------------------------------------agaac
A0A2K5M8B1_BCL2L1-      ggatccagg------------------------------------agaac
A0A2K5MZX9_BCL2L2-      gagtcagggagatggaggaagaagctgagaagctaaaggagctacagaac
A0A2K5MZX9_BCL2L2-      gagtcagggagatggaggaagaagctgagaagctaaaggagctacagaac
A0A2K5MZX9_BCL2L2-      gagtcagggagatggaggaagaagctgagaagctaaaggagctacagaac
A0A2K5MZX9_BCL2L2-      tatacgggg---------------------------------------ac
                                                                        * 

A0A2K5KHH8_BCL2A1-      aaggcaaa------------------------------------------
A0A2K5KHH8_BCL2A1-      aaggcaaa------------------------------------------
A0A2K5KHH8_BCL2A1-      aaggcaaa------------------------------------------
A0A2K5NZS5_BCL2-01      aacg----------------------------------------------
A0A2K5MMZ4_BCL2L10      gtcgcccgggactgccagcgcctggtggccttgctgagctcgc-------
A0A2K5LXU8_MCL1-02      ggcgtgcag---cgcaaccacgagacggccttccaa--------------
A0A2K5LXU8_MCL1-01      ggcgtgcag---cgcaaccacgagacggccttccaaggcatgcttcggaa
A0A2K5LXU8_MCL1-03      ggcgtgcag---cgcaaccacgagacggccttccaaggcatgcttcggaa
A0A2K5M8B1_BCL2L1-      ggcg--------------------------------------gctgggac
A0A2K5M8B1_BCL2L1-      ggcg--------------------------------------gctgggac
A0A2K5MZX9_BCL2L2-      gaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A2K5MZX9_BCL2L2-      gaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A2K5MZX9_BCL2L2-      gaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A2K5MZX9_BCL2L2-      gggg----------------------------------------------
                           *                                              

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      actgg------acatcaaaaacgaagacgatgtcaaatccttgtctcgag
A0A2K5LXU8_MCL1-03      actgg------acatcaaaaacgaagacgatgtcaaatccttgtctcgag
A0A2K5M8B1_BCL2L1-      a----------cttttgtggaa------------------------ctct
A0A2K5M8B1_BCL2L1-      a----------cttttgtggaa------------------------ctct
A0A2K5MZX9_BCL2L2-      agtgatcatgtccattgaggagaagatggaggctgatgcccgttccatct
A0A2K5MZX9_BCL2L2-      agtgatcatgtccattgaggagaagatggaggctgatgcccgttccatct
A0A2K5MZX9_BCL2L2-      agtgatcatgtccattgaggagaagatggaggctgatgcccgttccatct
A0A2K5MZX9_BCL2L2-      -----------ccctggaggaggcg-cggcgtctg---------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      tgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtg
A0A2K5LXU8_MCL1-03      tgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtg
A0A2K5M8B1_BCL2L1-      atgggaacaatg---------------cagcagccgagagccg-------
A0A2K5M8B1_BCL2L1-      atgggaacaatg---------------cagcagccgagagccg-------
A0A2K5MZX9_BCL2L2-      atgttggcaatgtggactatggtgcaacagcag--aagagctggaagctc
A0A2K5MZX9_BCL2L2-      atgttggcaatgtggactatggtgcaacagcag--aagagctggaagctc
A0A2K5MZX9_BCL2L2-      atgttggcaatgtggactatggtgcaacagcag--aagagctggaagctc
A0A2K5MZX9_BCL2L2-      ---------------------------cgggag--gggaactgg------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      actctcatttcttttggtgcctttgtggctaaacacttgaagaccataaa
A0A2K5LXU8_MCL1-03      actctcatttcttttggtgcctttgtggctaaacacttgaagaccataaa
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      actttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaa
A0A2K5MZX9_BCL2L2-      actttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaa
A0A2K5MZX9_BCL2L2-      actttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaa
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------ggctcg
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcg
A0A2K5LXU8_MCL1-03      ccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcg
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      tttagtggc-----------------------------------catccc
A0A2K5MZX9_BCL2L2-      tttagtggc-----------------------------------catccc
A0A2K5MZX9_BCL2L2-      tttagtggc-----------------------------------catccc
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      ------------------------------acggaggctgggggaaatgg
A0A2K5KHH8_BCL2A1-      ------------------------------acggaggct-gggaaaatgg
A0A2K5KHH8_BCL2A1-      ------------------------------acggaggct-gggaaaatgg
A0A2K5NZS5_BCL2-01      ---------------------------------gaggctggg----acgc
A0A2K5MMZ4_BCL2L10      cggggcagcaccgcgcctggcttcaggctcagggcggctggg----atgg
A0A2K5LXU8_MCL1-02      ----------------------------------------gg----atgg
A0A2K5LXU8_MCL1-01      taaggacaaaacgggactggctagttaaacaaagaggctggg----atgg
A0A2K5LXU8_MCL1-03      taaggacaaaacgggactggctagttaaacaaagaggctggg----atgg
A0A2K5M8B1_BCL2L1-      ------------------------------aaagggccag-g----agcg
A0A2K5M8B1_BCL2L1-      ------------------------------aaagggccag-g----agcg
A0A2K5MZX9_BCL2L2-      aaaggatttgcgtatatagagttctcagacaaagagtcagtg----agga
A0A2K5MZX9_BCL2L2-      aaaggatttgcgtatatagagttctcagacaaagagtcagtg----agga
A0A2K5MZX9_BCL2L2-      aaaggatttgcgtatatagagttctcagacaaagagtcagtg----agga
A0A2K5MZX9_BCL2L2-      ---------------------------------gcatcagtg----agga
                                                                 *    *   

A0A2K5KHH8_BCL2A1-      c-------------------------------------------------
A0A2K5KHH8_BCL2A1-      ctttgtaa------------------------------------------
A0A2K5KHH8_BCL2A1-      ctttgtaa------------------------------------------
A0A2K5NZS5_BCL2-01      ctttgtggaactgt------------------------------------
A0A2K5MMZ4_BCL2L10      cttttgtcacttct------------------------------------
A0A2K5LXU8_MCL1-02      gtttgtggagttct------------------------------------
A0A2K5LXU8_MCL1-01      gtttgtggagttct------------------------------------
A0A2K5LXU8_MCL1-03      gtttgtggagttct------------------------------------
A0A2K5M8B1_BCL2L1-      ctt-----------------------------------------------
A0A2K5M8B1_BCL2L1-      ctt-----------------------------------------------
A0A2K5MZX9_BCL2L2-      cttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtg
A0A2K5MZX9_BCL2L2-      cttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtg
A0A2K5MZX9_BCL2L2-      cttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtg
A0A2K5MZX9_BCL2L2-      c---------------------------------------------agtg
                                                                          

A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      ------------------------------------------acggcccc
A0A2K5MMZ4_BCL2L10      -------------------------------------tca----ggagcc
A0A2K5LXU8_MCL1-02      -------------------------------------tccatgtagagga
A0A2K5LXU8_MCL1-01      -------------------------------------tccatgtagagga
A0A2K5LXU8_MCL1-03      -------------------------------------tccatgtagagga
A0A2K5M8B1_BCL2L1-      -------------------------------------caaccgctggttc
A0A2K5M8B1_BCL2L1-      -------------------------------------caaccgctggttc
A0A2K5MZX9_BCL2L2-      atcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttt
A0A2K5MZX9_BCL2L2-      atcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttt
A0A2K5MZX9_BCL2L2-      atcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttt
A0A2K5MZX9_BCL2L2-      -------------------------------------ctgacggggg---
                                                                          

A0A2K5KHH8_BCL2A1-      ---acaatcacatgcctatg-ctagtagagtcagtggcccacaggaaga-
A0A2K5KHH8_BCL2A1-      ---agaagtttgaacctaaatctggctggatgacttttctagaagttac-
A0A2K5KHH8_BCL2A1-      ---agaagcttgagcctaaatctggctggatgacttttctagaagttac-
A0A2K5NZS5_BCL2-01      agcatgcggcctctgtttgatttctcctggctgtctctgaagactctgc-
A0A2K5MMZ4_BCL2L10      cctttccgctggctttttggagaacactgctga----tccaggctttcc-
A0A2K5LXU8_MCL1-02      cctagaaggtggc-atcagaaatgtgctgctggctgttgcaggtgttgc-
A0A2K5LXU8_MCL1-01      cctagaaggtggc-atcagaaatgtgctgctggctgttgcaggtgttgc-
A0A2K5LXU8_MCL1-03      cctagaaggtggc-atcagaaatgtgctgctggctgttgcaggtgttgc-
A0A2K5M8B1_BCL2L1-      ctgacgggcatg--------------------------------------
A0A2K5M8B1_BCL2L1-      ctgacgggcatg--------------------------------------
A0A2K5MZX9_BCL2L2-      tccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgct
A0A2K5MZX9_BCL2L2-      tccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgct
A0A2K5MZX9_BCL2L2-      tccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgct
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5KHH8_BCL2A1-      -------------------------agaaaatggctttgtaa--------
A0A2K5KHH8_BCL2A1-      -------------------------aggaaagatctgtgaaatgctatct
A0A2K5KHH8_BCL2A1-      -------------------------aggaaagatctgtgaaatgctctct
A0A2K5NZS5_BCL2-01      -tcagtttggccctgg---------tgggagcttgcatcaccctgggtgc
A0A2K5MMZ4_BCL2L10      -------------tggcatgcttgttagcaacagccttc-----ggttat
A0A2K5LXU8_MCL1-02      -------------tgg-------agtaggagctggtttg-----gcatat
A0A2K5LXU8_MCL1-01      -------------tgg-------agtaggagctggtttg-----gcatat
A0A2K5LXU8_MCL1-03      -------------tgg-------agtaggagctggtttg-----gcatat
A0A2K5M8B1_BCL2L1-      ---------actgtgg---------------ccggcgtg-----g--t-t
A0A2K5M8B1_BCL2L1-      ---------actgtgg---------------ccggcgtg-----g--t-t
A0A2K5MZX9_BCL2L2-      ctcgattctacagtggttttaacagcaggccccggggtc-----g--tgt
A0A2K5MZX9_BCL2L2-      ctcgattctacagtggttttaacagcaggccccggggtc-----g--tgt
A0A2K5MZX9_BCL2L2-      ctcgattctacagtggttttaacagcaggccccggggtc-----g--tgt
A0A2K5MZX9_BCL2L2-      ----------ccgtggc----actgggggccctg----------g--taa
                                                                          

A0A2K5KHH8_BCL2A1-      -------------------------------------------------
A0A2K5KHH8_BCL2A1-      ctcctgaagcaatactgt----------------------------tga
A0A2K5KHH8_BCL2A1-      cttctgaagcaatactgt----------------------------tga
A0A2K5NZS5_BCL2-01      ctatctgggcc------------------------------acaagtga
A0A2K5MMZ4_BCL2L10      ct--ctggacacgattatta--------------------------tga
A0A2K5LXU8_MCL1-02      ctaataagatagccttactg--------------------------taa
A0A2K5LXU8_MCL1-01      ctaataagatag-------------------------------------
A0A2K5LXU8_MCL1-03      ctaataagatag-------------------------------------
A0A2K5M8B1_BCL2L1-      ctgctgggctc-------------------actcttcagtcggaaatga
A0A2K5M8B1_BCL2L1-      ctgctgggctc-------------------actcttcagtcggaaatga
A0A2K5MZX9_BCL2L2-      ctacaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      ctacaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      ctacaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      ctgtaggggcc--------------------ttttttgctagcaagtga
                                                                         

© 1998-2022Legal notice