Dataset for CDS BCL-2-like of organism Mustela putorius furo

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M3Z2H9_BCL2L1-01       --------------atg---------------------------------
M3YYK3_BCL2-01         --------------atg---------------------------------
M3YVH4_BCL2A1-01       --------------atg---------------------------------
M3Y8D1_BCL2L10-01      --------------atg---------------------------------
M3XZZ5_MCL1-01         atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgg
M3Y5X5_BCL2L2-01       --------------aag---------------------------------
                                     * *                                 

M3Z2H9_BCL2L1-01       --------------------------------------------------
M3YYK3_BCL2-01         ---------------------------------gcgcacgctgggagaac
M3YVH4_BCL2A1-01       --------------------------------------------------
M3Y8D1_BCL2L10-01      -----------------------ggtgtggcggcccctccctgggcgga-
M3XZZ5_MCL1-01         gggggccgggctgggggccggcaccgggggcgcctcctcttcgggagggc
M3Y5X5_BCL2L2-01       -----------------------cctgaagcaccccttct----------

M3Z2H9_BCL2L1-01       -tctcagagcaaccgggagctggtggttgactttctctcctacaagcttt
M3YYK3_BCL2-01         agggtatgataaccgggagatagtgatgaagtacatccactataagctgt
M3YVH4_BCL2A1-01       -----------------------------------------acagacagt
M3Y8D1_BCL2L10-01      ggc-----gcagcgggacctagaaaaccgggt-----cgggtcgggcagc
M3XZZ5_MCL1-01         ggcttttggcttcgggga--aggaggccacgg-----cccggcgggaggt
M3Y5X5_BCL2L2-01       ggcttt--------------------------------------------

M3Z2H9_BCL2L1-01       cccagaaaggatacagctggagtcagtttagtgatgcagaagagaacaga
M3YYK3_BCL2-01         cgcagagggg--------aagaccagtgatgaaac---------------
M3YVH4_BCL2A1-01       gagt----------------------------------------------
M3Y8D1_BCL2L10-01      gcggggagag--------g-------------------------------
M3XZZ5_MCL1-01         agggggaggg--------gaagccggtgcggtgattggcggaagcgccgg
M3Y5X5_BCL2L2-01       --------------------------------------------------

M3Z2H9_BCL2L1-01       actgaggccccagaagggactgaatcagagatggagacccccagtgccat
M3YYK3_BCL2-01         ----------tcgtgt--acttaccca-------------ccgccccccc
M3YVH4_BCL2A1-01       ----------tcgggtacacgctgtcg-------------ctggccc---
M3Y8D1_BCL2L10-01      ----------tcgggc-------catg-------------gcggacgctt
M3XZZ5_MCL1-01         cgcgagtaccccggcc--actctcgcg-------------ccggacgccc
M3Y5X5_BCL2L2-01       ----------ccaaccatatattcacg-------------ccagcctttc

M3Z2H9_BCL2L1-01       caatggcaaccca--tcctggcacctg--gcggacagccctgcggtgaat
M3YYK3_BCL2-01         ---------cccaccccccctctcccgccacc-gccgcccgcagctcacc
M3YVH4_BCL2A1-01       --aggactacgtgaggcatgtcctgcagatcccgcagccc----------
M3Y8D1_BCL2L10-01      tgaggg-agcgcacggcgcagctgctg--accgactacctgga--gtact
M3XZZ5_MCL1-01         ggagggtcgcgcggccctcgcccattggcgccgagggccccaacgtcacc
M3Y5X5_BCL2L2-01       -------------atccttgactcttacagcc----gcccggatg-----
                                       *    *        *      **           

M3Z2H9_BCL2L1-01       gg-----------agccactg-----------------------------
M3YYK3_BCL2-01         tcccc--------ggccaccgccct-------------------------
M3YVH4_BCL2A1-01       -------------agcc---------------------------------
M3Y8D1_BCL2L10-01      gcgcccgc-----ggccccggcacc-------------------------
M3XZZ5_MCL1-01         gcgacccccccgaggctgctgttcttcgagcctacccaccgcgcgtcgcc
M3Y5X5_BCL2L2-01       gcgacccc-----ggcctcagcccc-------------------------

M3Z2H9_BCL2L1-01       ----------------gccacagcagcagct-------------------
M3YYK3_BCL2-01         ---------------cgccgccgctgccgcc-------------------
M3YVH4_BCL2A1-01       -----------------------cggccgcc-------------------
M3Y8D1_BCL2L10-01      -----------------cccgcgcggtcgcc-------------------
M3XZZ5_MCL1-01         gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaag
M3Y5X5_BCL2L2-01       ------agacacacgggctctagtggcagac-------------------
                                                *  *                     

M3Z2H9_BCL2L1-01       ------tggatgcccgggaggtgatcc---------------------cc
M3YYK3_BCL2-01         --------gcgggccctgcgctcagcc------------------ccgtg
M3YVH4_BCL2A1-01       ------------------agcagag-------------------------
M3Y8D1_BCL2L10-01      -----------gtctacgcgcgaggcc-----------------gcggtg
M3XZZ5_MCL1-01         aggagctggatgggtacgagccggaacctttggggaagaggcctgctgtc
M3Y5X5_BCL2L2-01       -----tttgtaggctataagctgaggc------agaagggttatg-----

M3Z2H9_BCL2L1-01       atggcagcggtaaagcaagcgctgagggaggctgggga------------
M3YYK3_BCL2-01         ccacctgtggtccacctgaccctgcgccaggccggcga------------
M3YVH4_BCL2A1-01       ----------tgtcccgggtcctgcgggacg-------------------
M3Y8D1_BCL2L10-01      ctgcgctcggtggccgccgtcgtgcggcagcgtcacgagcgcttcttgt-
M3XZZ5_MCL1-01         ctgcctttgctggagttggt----gggggaggccagcagtggcccctgca
M3Y5X5_BCL2L2-01       -----tttg-tggagctggccctggggagggcccagcagc----------
                                 *              *                        

M3Z2H9_BCL2L1-01       ----tgagtttgaac-----------------------------------
M3YYK3_BCL2-01         ----cgacttctcccgt---------------------------------
M3YVH4_BCL2A1-01       ----tggcctcct-------------------------------------
M3Y8D1_BCL2L10-01      ----cggattaccgc-----------------------------------
M3XZZ5_MCL1-01         cggacggctcactgccctcgacgccacccccagcagaggaggaggaagac
M3Y5X5_BCL2L2-01       ----tgacccactgcac--------------------------------c

M3Z2H9_BCL2L1-01       -tgaggtaccggcgg-----------------------------------
M3YYK3_BCL2-01         -cgctaccgccgcgacttcgcggagatg----------------------
M3YVH4_BCL2A1-01       ---ccgtgcagg--------gggaggtggaac------------------
M3Y8D1_BCL2L10-01      -ggctacggcggcaaccgcgtcgagctggtggctcagttggagcggga--
M3XZZ5_MCL1-01         gagttgtaccggcagtctc-tggagattatttctcggtacctgcgggagc
M3Y5X5_BCL2L2-01       aagccatgcgggcag---c-tggagatgagtt------------------

M3Z2H9_BCL2L1-01       --------------------------------------------gcattc
M3YYK3_BCL2-01         -----------------------------------------------tcc
M3YVH4_BCL2A1-01       ---------------agaacttgagaccat--------------gcttgg
M3Y8D1_BCL2L10-01      ----------------------gatactc---------------gc--cc
M3XZZ5_MCL1-01         aggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgcc
M3Y5X5_BCL2L2-01       ---------------------tgagaccc---------------gcttcc

M3Z2H9_BCL2L1-01       agc-------------------------gacctga----------catct
M3YYK3_BCL2-01         agc-----------------------------------------------
M3YVH4_BCL2A1-01       a--------------------cagctttgatgtggggtc------catcg
M3Y8D1_BCL2L10-01      acccccaag---------------ccctaagctggggccgtgtggtggcg
M3XZZ5_MCL1-01         agccggaaggcgttagagaccctccgacgggtcggggacggggtacagcg
M3Y5X5_BCL2L2-01       ggc--------------gtaccttctctgatttgg----------cagcc

M3Z2H9_BCL2L1-01       cagcttcacatcac------cccagggacagcgtatcagagctttgagca
M3YYK3_BCL2-01         cagctgcacctgacgcccttcaccg------cgaggggacgctttgccac
M3YVH4_BCL2A1-01       acactgc-cagaaccatcttcaa---------------------------
M3Y8D1_BCL2L10-01      ------ctcgtgac---cttcgcgggaacgctgctggagcgc--------
M3XZZ5_MCL1-01         caac--cacgagacggccttccaaggcatgcttcggaaactggacatcaa
M3Y5X5_BCL2L2-01       cagctgcatgtgac------cccaggctcggcccagcagcgcttcaccca
                             *     **      *                             

M3Z2H9_BCL2L1-01       g------------------------------gtggtgaacgaactcttcc
M3YYK3_BCL2-01         g------------------------------gtggtggaggagctcttca
M3YVH4_BCL2A1-01       ---------------------------tcaagtcatggaaaaggaatttg
M3Y8D1_BCL2L10-01      -----------------------------------------------ccg
M3XZZ5_MCL1-01         aaacgaagacgatgtcaaatctttgtctcgagtgatggtgcatgttttca
M3Y5X5_BCL2L2-01       g-----------------------gtctc------tgacgaactcttcca

M3Z2H9_BCL2L1-01       gggatgggg-------tgaac-tggggtcgcattgtggcctttttctcct
M3YYK3_BCL2-01         gggatgggg-------tgaac-tgggggaggattgtggccttctttgagt
M3YVH4_BCL2A1-01       aagacggcatca----ttaac-tgggggaggattgtgaccgtgtttgcct
M3Y8D1_BCL2L10-01      ccgtcgggggcctgctcgaacttggggccggacccgga-----actggaa
M3XZZ5_MCL1-01         gtgacggagtaa----caaac-tggggcaggattgtgactcttatttctt
M3Y5X5_BCL2L2-01       a----gggggcc----ccaac-tggggccgccttgtggccttctttgtct
                            **           *** *****  *      *             

M3Z2H9_BCL2L1-01       tcggtggggctctgtgtg----------tggagagcg----tagacaagg
M3YYK3_BCL2-01         tcggtggggtcatgtgtg----------tggagagcg----tcaaccggg
M3YVH4_BCL2A1-01       ttgaaggcattctctccaagaagctcctccgggagcgaatttccccggac
M3Y8D1_BCL2L10-01      ctggagc---------tgggggagtgggaggccagcg----ttcgccaag
M3XZZ5_MCL1-01         ttggtgc----ctttgtggccaaacacttgaagagta----taaaccaag
M3Y5X5_BCL2L2-01       ttggagccgcactgtgtg----------ctgagagtg----tcaacaaag
                         *  *                           **      *   *    

M3Z2H9_BCL2L1-01       ag------atgcaggcattggtgagtcggatcgcaacttggatggccact
M3YYK3_BCL2-01         ag------atgtcgcccctggtggacaacatcgccctatggatgactgag
M3YVH4_BCL2A1-01       gtggatgcttccagggtttctt--actttgtggcagagttcatcacgaca
M3Y8D1_BCL2L10-01      actgccg------gcgcctggtggacttcct-------ctgcggtcggct
M3XZZ5_MCL1-01         aaagctgcatcgaaccattagcaga--------aagcatcacagatgttc
M3Y5X5_BCL2L2-01       ag------atggagccacttgtgggccaagtgcaagagtggatggtggcc

M3Z2H9_BCL2L1-01       tacctgaacgaccacctagagccttggatccaggagaacggcggctg---
M3YYK3_BCL2-01         tacctgaaccggcacttgcacacctggatccaggacaacggaggctg---
M3YVH4_BCL2A1-01       aacatgagg------------gagtggataagacagaacggaggctggga
M3Y8D1_BCL2L10-01      cacagggcagcaccgc-----gcctggctggaggcgcacggcggctg---
M3XZZ5_MCL1-01         t-cgtaaggacaaaacga---gactggctagtcaaacaaagaggctg---
M3Y5X5_BCL2L2-01       tacctggagacgcggctggccgactggatccacagcagtgggggctg---
                         *                     *** *           * *****   

M3Z2H9_BCL2L1-01       ggacactttcgtggaactcta-----cgggaacaatgcagcagccgagag
M3YYK3_BCL2-01         gcctgcccccgc-----------cccccatgaaggtccagctgcc-----
M3YVH4_BCL2A1-01       ggatggctttgtaaagaagttcgagcccaagtccggctggctgacctttc
M3Y8D1_BCL2L10-01      ggatggcttttgtctcttcttcacacccgcgct------gctgtc----t
M3XZZ5_MCL1-01         ggatgggtttgtggagttctt-----ccatgta------gaggac----c
M3Y5X5_BCL2L2-01       ggcggagttcacagctctata-----cggggac------ggggcc----c
                       *                         *            *  * *     

M3Z2H9_BCL2L1-01       ccggaagggc--------------------------------caggagcg
M3YYK3_BCL2-01         ----------------------------------------------agac
M3YVH4_BCL2A1-01       tggaagttat----------------------------------aggaaa
M3Y8D1_BCL2L10-01      tggaaaagac----------------------------------------
M3XZZ5_MCL1-01         tagaag----gtggcatc--------------------------agaaat
M3Y5X5_BCL2L2-01       tggaggaggcgcggcgtctgcgggaggggaactgggcctcagtgaggaca

M3Z2H9_BCL2L1-01       cttcaaccgctggttcctga--caggcatgactgtggctggcgtggttct
M3YYK3_BCL2-01         ctattgttgatgattcctac----tggcccaaagtgttttccttgcttgc
M3YVH4_BCL2A1-01       gatctgtgaaatgttctctc------tcctgaagcaatactactga----
M3Y8D1_BCL2L10-01      -tgctggtccaggctcttctgtcatgctttacggcagtgatcttaatcta
M3XZZ5_MCL1-01         gtgctgct---ggc------------ttttgca--ggtgttgctgg----
M3Y5X5_BCL2L2-01       gtgctgacaggggc------------cgtggcactgggggccctggtaac

M3Z2H9_BCL2L1-01       gctgggctcactcttca-----gtcggaaatga-
M3YYK3_BCL2-01         c---------------------------------
M3YVH4_BCL2A1-01       ----------------------------------
M3Y8D1_BCL2L10-01      cttctggaaaagattaccat--ttattgggtga-
M3XZZ5_MCL1-01         agtaggagctggtttggcatatctaataagatag
M3Y5X5_BCL2L2-01       tgtaggggccttttttg-----ctagcaagtga-

© 1998-2022Legal notice