Dataset for CDS BCL-2-like of organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C0CSU7_BCL2A1-      atg----------------------------------------accgaca
A0A8B8VBB9_BCL2L1-      atgt----------ctcag--------------------agcaaccggga
A0A8B8V3A7_BCL2-02      atgg------------cgcacgctgggagaacagggtatgataaccggga
A0A8B8V3A7_BCL2-01      atgg------------cgcacgctgggagaacagggtatgataaccggga
A0A8B8V3A7_BCL2-03      atgg------------cgcacgctgggagaacagggtatgataaccggga
A0A8B8WSS7_BCL2L2-      atggcgaccccagcctcggcccc-----agaca-----ca-----cgggc
A0A8C0CVU0_MCL1-01      atg-----------ctcggcctcaagagaaaca-----cagtaatcggac
A0A8C0DF47_MCL1-02      atg-----------ttcggcctcaagagaaacg-----cagtaatcggac
A0A8C0DF47_MCL1-01      atg-----------ttcggcctcaagagaaacg-----cagtaatcggac
A0A8C0DF47_MCL1-03      atg-----------ttcggcctcaagagaaacg-----cagtaatcggac
                        ***                                          **   

A0A8C0CSU7_BCL2A1-      gcgagt--ttggctatat---tcacatgctggcccaggactacctgaagt
A0A8B8VBB9_BCL2L1-      gctggtggttgactttctctcctacaagctttcccagaa------aggat
A0A8B8V3A7_BCL2-02      gatagtgatgaagtacatccactataagctgtcgcagag------gggct
A0A8B8V3A7_BCL2-01      gatagtgatgaagtacatccactataagctgtcgcagag------gggct
A0A8B8V3A7_BCL2-03      gatagtgatgaagtacatccactataagctgtcgcagag------gggct
A0A8B8WSS7_BCL2L2-      tctagtggcagactttgtaggctataagctaaggcagaa------gggtt
A0A8C0CVU0_MCL1-01      tcaaac--tctactg-gggggaaccggattgggacc--------------
A0A8C0DF47_MCL1-02      tcaacc--tctactgtgggggggccggattggggccgga------tagcg
A0A8C0DF47_MCL1-01      tcaacc--tctactgtgggggggccggattggggccgga------tagcg
A0A8C0DF47_MCL1-03      tcaacc--tctactgtgggggggccggattggggccgga------tagcg
                                     *               *    *               

A0A8C0CSU7_BCL2A1-      acgtct-------------tgcagataccacagcctggatctggtccaag
A0A8B8VBB9_BCL2L1-      acagctggagtcagtttagtgatgtggacgagaacagaactgaggcccca
A0A8B8V3A7_BCL2-02      acgagt------------gggatgccggagacgcaggcaccgcgtccccg
A0A8B8V3A7_BCL2-01      acgagt------------gggatgccggagacgcaggcaccgcgtccccg
A0A8B8V3A7_BCL2-03      acgagt------------gggatgccggagacgcaggcaccgcgtccccg
A0A8B8WSS7_BCL2L2-      atgttt------------gtggagctgg-----------------cccag
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gcagcg------------gcgcctccgc-----------------tccag
A0A8C0DF47_MCL1-01      gcagcg------------gcgcctccgc-----------------tccag
A0A8C0DF47_MCL1-03      gcagcg------------gcgcctccgc-----------------tccag

A0A8C0CSU7_BCL2A1-      caaaaca-------------------------------------------
A0A8B8VBB9_BCL2L1-      gaaggga-------------------------------------------
A0A8B8V3A7_BCL2-02      ggggccg-------------------------------------------
A0A8B8V3A7_BCL2-01      ggggccg-------------------------------------------
A0A8B8V3A7_BCL2-03      ggggccg-------------------------------------------
A0A8B8WSS7_BCL2L2-      gggaggg-------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggta
A0A8C0DF47_MCL1-01      gaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggta
A0A8C0DF47_MCL1-03      gaaggcggctttt-------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gggggaggggaaaccggcgaggtgattggcggaagcgccggcccgagccc
A0A8C0DF47_MCL1-01      gggggaggggaaaccggcgaggtgattggcggaagcgccggcccgagccc
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      cccggccactctcgcgcccgacgcccggagggtcgcgcggccctcgccca
A0A8C0DF47_MCL1-01      cccggccactctcgcgcccgacgcccggagggtcgcgcggccctcgccca
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      ------------------------------------------------cc
A0A8B8V3A7_BCL2-01      ------------------------------------------------cc
A0A8B8V3A7_BCL2-03      ------------------------------------------------cc
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ttggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttc
A0A8C0DF47_MCL1-01      ttggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttc
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      ------------------ctgaatcagacatggaaacccccagtgccatc
A0A8B8V3A7_BCL2-02      cccgcgccaggcatcttctcctcccagcctgggcgcaccccagcgccatc
A0A8B8V3A7_BCL2-01      cccgcgccaggcatcttctcctcccagcctgggcgcaccccagcgccatc
A0A8B8V3A7_BCL2-03      cccgcgccaggcatcttctcctcccagcctgggcgcaccccagcgccatc
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ttcgcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggc
A0A8C0DF47_MCL1-01      ttcgcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggc
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      aatggcaacccgt-------------------------------------
A0A8B8V3A7_BCL2-02      caggacctccccgccgccgccccagaccgcccccgccgcccccg------
A0A8B8V3A7_BCL2-01      caggacctccccgccgccgccccagaccgcccccgccgcccccg------
A0A8B8V3A7_BCL2-03      caggacctccccgccgccgccccagaccgcccccgccgcccccg------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccgg
A0A8C0DF47_MCL1-01      ctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccgg
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      agcctctagggaagcggccggccgtcctgcctttgctggagttggtcggc
A0A8C0DF47_MCL1-01      agcctctagggaagcggccggccgtcctgcctttgctggagttggtcggc
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gaggccagtaacagccccggcaaggacggctcactcccctcgacgccgcc
A0A8C0DF47_MCL1-01      gaggccagtaacagccccggcaaggacggctcactcccctcgacgccgcc
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      cccagcagaggaggaggaggacgagttgtaccggcagtccctggagatta
A0A8C0DF47_MCL1-01      cccagcagaggaggaggaggacgagttgtaccggcagtccctggagatta
A0A8C0DF47_MCL1-03      --------------------------------------------------

A0A8C0CSU7_BCL2A1-      ------------tccagggtgttacaa-----------------------
A0A8B8VBB9_BCL2L1-      ------------cctggcacctggcagacagccctgcggtgaatggagcc
A0A8B8V3A7_BCL2-02      ------------ccggggggcctgcgctcagccccgtg------------
A0A8B8V3A7_BCL2-01      ------------ccggggggcctgcgctcagccccgtg------------
A0A8B8V3A7_BCL2-03      ------------ccggggggcctgcgctcagccccgtg------------
A0A8B8WSS7_BCL2L2-      ------------cccagcagctgacccgctgcaccaag------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      tctctcgatacctccgggagcaggcaaccggcaccaagg--------acg
A0A8C0DF47_MCL1-01      tctctcgatacctccgggagcaggcaaccggcaccaagg--------acg
A0A8C0DF47_MCL1-03      ----------------------ggcaaccggcaccaagg--------acg

A0A8C0CSU7_BCL2A1-      -----------------------------gacattgctttctcag-----
A0A8B8VBB9_BCL2L1-      actggccacagcagcagcttggatgcccgggaggtgatccccatggcagc
A0A8B8V3A7_BCL2-02      ---------------------------ccacctgtggtccacctg-----
A0A8B8V3A7_BCL2-01      ---------------------------ccacctgtggtccacctg-----
A0A8B8V3A7_BCL2-03      ---------------------------ccacctgtggtccacctg-----
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      cgaagccactgggcaggtctggggccgccagccggaaggcgttag-----
A0A8C0DF47_MCL1-01      cgaagccactgggcaggtctggggccgccagccggaaggcgttag-----
A0A8C0DF47_MCL1-03      cgaagccactgggcaggtctggggccgccagccggaaggcgttag-----

A0A8C0CSU7_BCL2A1-      -----------tccaaaacgaagttgaaaagaatttgaaacc--------
A0A8B8VBB9_BCL2L1-      ggtgaagcaagcgctgagggaggcaggtgatgagtt------------tg
A0A8B8V3A7_BCL2-02      --------a--ccctgcgccaggccggtgatgatttctctcg--------
A0A8B8V3A7_BCL2-01      --------a--ccctgcgccaggccggtgatgatttctctcg--------
A0A8B8V3A7_BCL2-03      --------a--ccctgcgccaggccggtgatgatttctctcg--------
A0A8B8WSS7_BCL2L2-      -----------ccatgcgggcagctggagatgagtt------------cg
A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------agaccctgcgacgggtcggggacggtgtgcaacggaaccacg
A0A8C0DF47_MCL1-01      --------agaccctgcgacgggtcggggacggtgtgcaacggaaccacg
A0A8C0DF47_MCL1-03      --------agaccctgcgacgggtcggggacggtgtgcaacggaaccacg

A0A8C0CSU7_BCL2A1-      --------------------attc-----ttggacaatattgatgt-tgt
A0A8B8VBB9_BCL2L1-      aactgaggtaccggcgggc-attcagcgacctgacatcccagctccacat
A0A8B8V3A7_BCL2-02      ----tcgctaccgccgcga-cttcgccgagatgtccagccagctgcacct
A0A8B8V3A7_BCL2-01      ----tcgctaccgccgcga-cttcgccgagatgtccagccagctgcacct
A0A8B8V3A7_BCL2-03      ----tcgctaccgccgcga-cttcgccgagatgtccagccagctgcacct
A0A8B8WSS7_BCL2L2-      agacccgcttccggcgcac-cttctccgatctggcagctcagctgcatgt
A0A8C0CVU0_MCL1-01      agacggccttccaaggcatgcttcagaaactggacatcaaaaacgaagac
A0A8C0DF47_MCL1-02      agacggccttccaa------------------------------------
A0A8C0DF47_MCL1-01      agacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
A0A8C0DF47_MCL1-03      agacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac

A0A8C0CSU7_BCL2A1-      gtccatagacaccgccagaacaatattcaaccaag-tgatggaaagggaa
A0A8B8VBB9_BCL2L1-      caccccagggacggcatatcagagctttgagcagg-tagtgaacgaactc
A0A8B8V3A7_BCL2-02      gacgcccttcaccgcgaggggacgctttgccacgg-tggtggaggagctc
A0A8B8V3A7_BCL2-01      gacgcccttcaccgcgaggggacgctttgccacgg-tggtggaggagctc
A0A8B8V3A7_BCL2-03      gacgcccttcaccgcgaggggacgctttgccacgg-tggtggaggagctc
A0A8B8WSS7_BCL2L2-      gaccccgggctcggcccagcaacgcttcacccaggtctctgatgaactct
A0A8C0CVU0_MCL1-01      ga--------------tgtcaaatctttgtctcgagtgatggtccatgtt
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      ga--------------tgtcaaatctttgtctcgagtgatggtccatgtt
A0A8C0DF47_MCL1-03      ga--------------tgtcaaatctttgtctcgagtgatggtccatgtt

A0A8C0CSU7_BCL2A1-      tttgaagatggcatcgttaactggggaaggattgtgaccatatttgcatt
A0A8B8VBB9_BCL2L1-      ttccgggatggggt---gaactggggtcgcattgtggcctttttctcctt
A0A8B8V3A7_BCL2-02      ttcagggatggggt---gaactgggggaggattgtggccttctttgagtt
A0A8B8V3A7_BCL2-01      ttcagggatggggt---gaactgggggaggattgtggccttctttgagtt
A0A8B8V3A7_BCL2-03      ttcagggatggggt---gaactgggggaggattgtggccttctttgagtt
A0A8B8WSS7_BCL2L2-      tccaa----gggggccccaactggggccgccttgtggctttctttgtctt
A0A8C0CVU0_MCL1-01      ttcagtgacggagttacaaactggggcaggattgtgactcttctttcttt
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      ttcagtgacggagtaacaaactggggcaggattgtgactctcatttcttt
A0A8C0DF47_MCL1-03      ttcagtgacggagtaacaaactggggcaggattgtgactctcatttcttt

A0A8C0CSU7_BCL2A1-      tgaaggtattctcatcaagaaacttctaggagagcgaattgccccag---
A0A8B8VBB9_BCL2L1-      cggtggggcactgtgcg----------tggaaagcgtagacaaggag---
A0A8B8V3A7_BCL2-02      cggtggggtcatgtgtg----------tggagagcgtcaaccgggag---
A0A8B8V3A7_BCL2-01      cggtggggtcatgtgtg----------tggagagcgtcaaccgggag---
A0A8B8V3A7_BCL2-03      cggtggggtcatgtgtg----------tggagagcgtcaaccgggag---
A0A8B8WSS7_BCL2L2-      tggagccgcgctgtgtg----------ctgagagtgtcaacaaggag---
A0A8C0CVU0_MCL1-01      tggtgc----ctttgtggccaaacacttgaggagtataaaccaagaaatc
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      tggtgc----ctttgtggccaaacacttgaagagtataaaccaagaaagc
A0A8C0DF47_MCL1-03      tggtgc----ctttgtggccaaacacttgaagagtataaaccaagaaagc

A0A8C0CSU7_BCL2A1-      ---atgtggacacttacaaggag-atttcttactttgttgcagagttcat
A0A8B8VBB9_BCL2L1-      ---atgcaggtattggtgagtcggatcgcagcttggatggccacttacct
A0A8B8V3A7_BCL2-02      ---atgtcccccctggtggacaacatcgccctgtggatgactgagtacct
A0A8B8V3A7_BCL2-01      ---atgtcccccctggtggacaacatcgccctgtggatgactgagtacct
A0A8B8V3A7_BCL2-03      ---atgtcccccctggtggacaacatcgccctgtggatgactgagtacct
A0A8B8WSS7_BCL2L2-      ---atggagccacttgtgggacaagtgcaggagtggatggtggcctacct
A0A8C0CVU0_MCL1-01      tgcatcgaaccattagcagaaagcat---------cacagatgttctcgt
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      tgcatcgaaccattagcagaaagcat---------cacagatgttctcgt
A0A8C0DF47_MCL1-03      tgcatcgaaccattagcagaaagcat---------cacagatgttctcgt

A0A8C0CSU7_BCL2A1-      aaccaaaaacacaggagaatggataaggcagaacggaggctgggaa----
A0A8B8VBB9_BCL2L1-      gaatgaccacctagagccttggatccaggagaacggcggctgg-------
A0A8B8V3A7_BCL2-02      gaaccgacacctgcacacctggatccaggataacggaggctggcacattc
A0A8B8V3A7_BCL2-01      gaaccgacacctgcacacctggatccaggataacggaggctgg-------
A0A8B8V3A7_BCL2-03      gaaccgacacctgcacacctggatccaggataacggaggctgg-------
A0A8B8WSS7_BCL2L2-      ggagacgcggctggccgactggatccacagcagcgggggctgg-------
A0A8C0CVU0_MCL1-01      aaggacaaaacaa---gactggctagtcaaacgaagaggctgg-------
A0A8C0DF47_MCL1-02      ------------------------------------------g-------
A0A8C0DF47_MCL1-01      aaggacaaaacga---gactggctagtcaaacaaagaggctgg-------
A0A8C0DF47_MCL1-03      aaggacaaaacga---gactggctagtcaaacaaagaggctgg-------

A0A8C0CSU7_BCL2A1-      ---------------------aatggctttgtaaagaagtttgaacccaa
A0A8B8VBB9_BCL2L1-      ---------------------gacactttcgtggaactctatgggaacaa
A0A8B8V3A7_BCL2-02      cactcatcattgttattaactatttcttctgcgcttcacatttgtctgaa
A0A8B8V3A7_BCL2-01      ---------------------gatgcctttgtggagctgtatggtcccag
A0A8B8V3A7_BCL2-03      ---------------------a-----------------------caaaa
A0A8B8WSS7_BCL2L2-      ---------------------gcggagttcacagctctatacggggacgg
A0A8C0CVU0_MCL1-01      ---------------------gatgggtttttggacttcttccatggaga
A0A8C0DF47_MCL1-02      ---------------------gatgggtttgtggacttcttccatgtaga
A0A8C0DF47_MCL1-01      ---------------------gatgggtttgtggacttcttccatgtaga
A0A8C0DF47_MCL1-03      ---------------------gatgggtttgtggacttcttccatgtaga

A0A8C0CSU7_BCL2A1-      --atctggctg----gctgacttttctggaagttac-------------a
A0A8B8VBB9_BCL2L1-      tgcagcagccgagagccggaagggccaggagcgcttcaaccgctggttcc
A0A8B8V3A7_BCL2-02      ctt------------ggaacatatgctta------cgaagctgttggaaa
A0A8B8V3A7_BCL2-01      cat------------gcggcctctgtttgatttctcctggctgtctctga
A0A8B8V3A7_BCL2-03      gat------------aaa-----------------cccagctgtccttca
A0A8B8WSS7_BCL2L2-      ggccctggaggaggcgcggcgtctgcgggaggggaactgggcctcagtga
A0A8C0CVU0_MCL1-01      ggacctagcaa----acggcctc--------------------------a
A0A8C0DF47_MCL1-02      ggacctagaag----gcggcatc--------------------------a
A0A8C0DF47_MCL1-01      ggacctagaag----gcggcatc--------------------------a
A0A8C0DF47_MCL1-03      ggacctagaag----gcggcatc--------------------------a

A0A8C0CSU7_BCL2A1-      ggaatgatctgtgaaatattatgtctcctgaagcagtactattga-----
A0A8B8VBB9_BCL2L1-      tgacgggcatg------actgtggctggcgt---ggttctgctgg-----
A0A8B8V3A7_BCL2-02      cttcccaagcc------tatttgattctgct---gatatt--------tc
A0A8B8V3A7_BCL2-01      aggcactgctc------agtctggccctggt---gggagcttgcgtcacc
A0A8B8V3A7_BCL2-03      -----------------------------gt---gagaat----------
A0A8B8WSS7_BCL2L2-      ggacagtgctg------acgggggccgtggcactgggggccctggtaact
A0A8C0CVU0_MCL1-01      gaaatgtgctg------ct---ggcttttgca--ggtgttgctgg----a
A0A8C0DF47_MCL1-02      gaaatgtgctg------ct---ggcttttgca--ggtgttgccgg----a
A0A8C0DF47_MCL1-01      gaaatgtgctg------ct---ggcttttgca--ggtgttgccgg----a
A0A8C0DF47_MCL1-03      gaaatgtgctg------ct---ggcttttgca--ggtgttgccgg----a

A0A8C0CSU7_BCL2A1-      -----------------------------------------
A0A8B8VBB9_BCL2L1-      ------gctcgctcttca---gtcggaaatga---------
A0A8B8V3A7_BCL2-02      catagtg----------------------tga---------
A0A8B8V3A7_BCL2-01      ctgggtgcctatctgg-----gccataagtga---------
A0A8B8V3A7_BCL2-03      ---gatgac----------------ggaatga---------
A0A8B8WSS7_BCL2L2-      gtaggggccttttttg-----ctagcaagtga---------
A0A8C0CVU0_MCL1-01      gtaggagctggtttggcgtatctaatacgatag--------
A0A8C0DF47_MCL1-02      gtaggagctggtttggcgtatctaataagatagccttttaa
A0A8C0DF47_MCL1-01      gtaggagctggtttggcgtatctaataagatag--------
A0A8C0DF47_MCL1-03      gtaggagctggtttggcgtatctaataagatag--------

© 1998-2023Legal notice