Dataset for CDS MCL-1 of organism Serinus canaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9NTQ6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Serinus canaria GN=MCL-1 (length=561 residues).
atggaacaaactgcattttgcagagcccctggagtcccacatcgcccattttggctcttaccgtggcgcccaacgtgcgg
cacccttagtaggagcctgaatgagggatgtgggtgtccaggcctgcctgcagctggagctggcagctgtggtcccacat
tgctcattttggctcctgcccccgtgggttttgcagggatgctgaggaggctgcagatccagcaggaggaggacctgcag
agcgtggtggaggtggctgcccagatgttcagtgacggtgtcaccaactggggacgggtggtgaccctcatcaccttcgg
cgccttcgtggccaagcacctgaagagcatccagcaggagcagagcatcagcagcctggctggcatcatcaccgacgccc
tggtctcctccaagagggagtggctggagagccaggggggctgggagggctttgtggactttttccgcgtggaggacctg
gagggcagcatccggaacgttctgatggccttcgcgggggtggccggcctgggggccagcctggcctacatgatccggtg
a
© 1998-2023Legal notice