Dataset for CDS BAX-like of Organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1ANM8_BOK-01      atg-----------gagatgttgcgccgctcctctgtgtttgcggctgaa
A0A3Q1AZQ5_BOK-01      atg-----------gaggtgctgcgtcggtcctctgtgtttgctgcagag
A0A3Q1CKY3_BAX-01      atggcatcacacccgggaggaggcg-----ac-------------caagg
A0A3Q1CTC5_BAX-01      atgtc-tgacagccgagacgaggagaaatcac-------------cggga
                       ***           * *  *  * *      *             *    

A0A3Q1ANM8_BOK-01      ---------gtgtttgaccgatcgcccaccgacaaggagctggtgtccca
A0A3Q1AZQ5_BOK-01      gtgctggatgtgtttgaccgatcgctgactgagaaggagctggtgtccca
A0A3Q1CKY3_BAX-01      aaatggcaa----agaacagctcgtggaagtaggag--------------
A0A3Q1CTC5_BAX-01      gagcaggaacctcagggcg--ccgtgggcggagaag--------------
                                        *    **       *  **              

A0A3Q1ANM8_BOK-01      ggccaaagctctgtgcagagactacatcca-ctccagg-----------c
A0A3Q1AZQ5_BOK-01      gtccaaagctctgtgcagagactacatcct-gtccaga-----------c
A0A3Q1CKY3_BAX-01      -----ctgctttgttaaaggacttcatttttgagcggg-----------t
A0A3Q1CTC5_BAX-01      -----atg--ttatt-gatgatcccatcttggagcagggagcagtggtcc
                              *   * *     **   ***       * *             

A0A3Q1ANM8_BOK-01      tgaaccggaccgggatcggctggtctaaacccg--agcacggactggctg
A0A3Q1AZQ5_BOK-01      tcaaccagaacgggctgggatggtctaaaactg--agatcaactttggtc
A0A3Q1CKY3_BAX-01      tcagcg---------------gcatggagacagtaaaactgtagtgacaa
A0A3Q1CTC5_BAX-01      tcagagggtatgtgattgaacgtataaacacag-aagaccctagtcggca
                       * *                  *     *  * *  *        *     

A0A3Q1ANM8_BOK-01      catc--------------aggtgggactctgg--g---------------
A0A3Q1AZQ5_BOK-01      cgtc--------------caatgcagcgctggccg---------------
A0A3Q1CKY3_BAX-01      gagcacagctggg-----tggaggagagctggttgaccca----agccat
A0A3Q1CTC5_BAX-01      cgtctcctctgaggatctgggaggaaggccggatgaactacaggatccac
                          *                  *     * **  *               

A0A3Q1ANM8_BOK-01      -------agaggtctctggtgtc---ctgctgtggctgggtgatgagttg
A0A3Q1AZQ5_BOK-01      -------aggtgtctctggtg-----cttctctgtctcggcgacgagctg
A0A3Q1CKY3_BAX-01      ------aagaagc--tcggtcagtgcctgcagcagattggagatgagctg
A0A3Q1CTC5_BAX-01      aaattaaagaagtggtggatcag---cttctcaagatagctgatgaactg
                              **  *     * *      ** *      * *  ** **  **

A0A3Q1ANM8_BOK-01      gaatatcttcgtcccaacgtgtatcgcaacgtcgcccgacagctgaacat
A0A3Q1AZQ5_BOK-01      gagtgtatacagcccagtctgtacaggaacgtggcgcggcagctcaacat
A0A3Q1CKY3_BAX-01      g---------------------atggaaatgtggaactccagaggatgat
A0A3Q1CTC5_BAX-01      a---------------------acaggaacgctgagctccagcgacttat
                                             *  * ** *  *  *  ***      **

A0A3Q1ANM8_BOK-01      cacagtagcttcagagagcattgtgtctgatgccttcctggctgtcgctg
A0A3Q1AZQ5_BOK-01      ttctgttgccatggagaacatggtttcggatgccttcattggcgtggcaa
A0A3Q1CKY3_BAX-01      aaatgattcctcactcagtcctacaaaaggcgtgtttctgaaagttgctg
A0A3Q1CTC5_BAX-01      caaccaggttcagggaaactgtgctcaggacatcttcatgaaggtcgcca
                                       *           *     **  *    ** **  

A0A3Q1ANM8_BOK-01      cagatattttctccacaggtg---tgacatgggggaaggtggtttccctg
A0A3Q1AZQ5_BOK-01      cggagatcttctctgcaggta---taacatggggtaaggtggtatccatg
A0A3Q1CKY3_BAX-01      ttgagatcttttcagatggaaaatttaactggggcagggtagttgcgctg
A0A3Q1CTC5_BAX-01      ggagcatctttgctgatggaa---ttaactggggtcgagtggtggctctc
                            ** **  *    **     * *  *****    ** **  *  * 

A0A3Q1ANM8_BOK-01      tacgctgtggc---------------aggagctctggcggtggactgtgt
A0A3Q1AZQ5_BOK-01      tacgcagtagc---------------tggagccctggcagtcgactgtgt
A0A3Q1CKY3_BAX-01      ttctactttgcctgtcgactcgtcattaaggctcttgtaacccaa-----
A0A3Q1CTC5_BAX-01      tttcatctggcctacagacttatatacaaggctctgactaccaac-----
                       *      * **                   ** **        *      

A0A3Q1ANM8_BOK-01      tcgccacggtcatcctgctatggtccacaccattgtggactgcatggggg
A0A3Q1AZQ5_BOK-01      cagacaaggccatccaaccacagtacacatcttagtggacagtctgggac
A0A3Q1CKY3_BAX-01      ----------gttcctgatatcatcagaaccattattcattggaccatgg
A0A3Q1CTC5_BAX-01      ----------catttagagaacatcagaatggttatcagctgggttctcc
                                   *      *   *    *   *  *     *        

A0A3Q1ANM8_BOK-01      agtttgtccgcaagagtctgacctcctggttaaagaggagaggaggctgg
A0A3Q1AZQ5_BOK-01      agtttgttcgcaaattcctggttccctggctgaaaagacgaggaggatgg
A0A3Q1CKY3_BAX-01      actacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
A0A3Q1CTC5_BAX-01      aagtcattagagagcagctctatgcctggcttgtgcagcagggaggctgg
                       *     *  *  *     *      **** *          ** ** ***

A0A3Q1ANM8_BOK-01      gcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctca
A0A3Q1AZQ5_BOK-01      gctgagattacaaaatgtgtggtgaagaaggatctcacccctgaacaaaa
A0A3Q1CKY3_BAX-01      gaggg---t-----attcgttcccacttcggcactcccacatggcagaca
A0A3Q1CTC5_BAX-01      gagggggtg-----atccgt---------agcttttctcgatggaggaca
                       *  *          **  **          *                  *

A0A3Q1ANM8_BOK-01      ctggctggtgtctgctgtctttgcctttggacactacctgaaggccgtcg
A0A3Q1AZQ5_BOK-01      ctggttctcctctactgtggagtctctcacgtacttcctga---ccacaa
A0A3Q1CKY3_BAX-01      gtgggagttttct-------------tggcaggcgttctca---ccactg
A0A3Q1CTC5_BAX-01      gcagccatagtag-------------catcagtcgtactgg---tggcaa
                          *      *                      *   **           

A0A3Q1ANM8_BOK-01      tgt---tgtacctcctcagggagaagtga
A0A3Q1AZQ5_BOK-01      tgtacgtctacatcatgaaggagccgtga
A0A3Q1CKY3_BAX-01      ttcttgtcattcgcaagatg------tga
A0A3Q1CTC5_BAX-01      cttttgtttatctcaggaggacacgctga
                             *      *   * *      ***

© 1998-2020Legal notice