Dataset for CDS BAX-like of organism Amphiprion ocellaris

[Download (right click)] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A3Q1AZQ5_BOK-01      atggaggtgctgcgtcggtcctctgtgtttgctgca----gaggtgctgg
A0A3Q1ANM8_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggct----ga--------
A0A3Q1CTC5_BAX-01      atgtc-t--------gacagccgagacgaggagaaatcaccg--------
A0A3Q1CKY3_BAX-01      atggcat--------cacacccgggaggaggcgacc----aa--------
                       ***                 *   *     *                   

A0A3Q1AZQ5_BOK-01      atgtgtttgaccgatcgctgactgagaaggagctggtgtcccagtccaaa
A0A3Q1ANM8_BOK-01      -agtgtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaa
A0A3Q1CTC5_BAX-01      --------------ggagagcaggaacctcagggcgccgtgggcggagaa
A0A3Q1CKY3_BAX-01      --------------ggaaatggcaaagaacagctcgtggaagtaggagct
                                               *     **   *              

A0A3Q1AZQ5_BOK-01      gctctgtgcagagactacatcctgtccaga-ctcaaccagaacgg-----
A0A3Q1ANM8_BOK-01      gctctgtgcagagactacatccactccagg-ctgaaccggaccgg-----
A0A3Q1CTC5_BAX-01      gatgttattgatgatcccatcttggagcagggagcagtggtcctcagagg
A0A3Q1CKY3_BAX-01      gctttgttaaaggacttcatttttgagcgg-gttcagcggcatggagaca
                       * * *       **   ***               *   *          

A0A3Q1AZQ5_BOK-01      ------gctgggatggtctaaaactg-agatcaactttggt--ccgtcca
A0A3Q1ANM8_BOK-01      ------gatcggctggtctaaacccg-agcacggactggct--gcatcag
A0A3Q1CTC5_BAX-01      gtatgtgattgaacgtataaacacagaagaccctagtcggcacgtctcct
A0A3Q1CKY3_BAX-01      gtaaaact------------------------gtagtgacaagagcacag
                                                           *          *  

A0A3Q1AZQ5_BOK-01      atgcagcgctggccgaggtgtctctggtgctt---------------ctc
A0A3Q1ANM8_BOK-01      gtgggactctgggagaggtctctggtgtcctg---------------ctg
A0A3Q1CTC5_BAX-01      ctgaggatctgggaggaaggccggatgaactacaggatccacaaattaaa
A0A3Q1CKY3_BAX-01      ct-----gggtggaggagagctggttga---------cccaagccataag
                        *         *  *           *                       

A0A3Q1AZQ5_BOK-01      tgtctcggcgacgagctggagtgtatacagcccagtctgtacaggaacgt
A0A3Q1ANM8_BOK-01      tggctgggtgatgagttggaatatcttcgtcccaacgtgtatcgcaacgt
A0A3Q1CTC5_BAX-01      gaagtggtggatcagcttctcaagatagctgatgaactgaacaggaacgc
A0A3Q1CKY3_BAX-01      aagctcggtcagtgcctgcagcagattggagatgagctggatggaaatgt
                           * *   *     *        *           ** *  * ** * 

A0A3Q1AZQ5_BOK-01      ggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatg
A0A3Q1ANM8_BOK-01      cgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatg
A0A3Q1CTC5_BAX-01      tgagctccagcgacttatcaaccaggttcagggaaactgtgctcaggaca
A0A3Q1CKY3_BAX-01      ggaactccagaggatgataaatgattcctcactcagtcctacaaaaggcg
                        *  *  ***      **                *           *   

A0A3Q1AZQ5_BOK-01      ccttcattggcgtggcaacggagatcttctctgcaggta---taacatgg
A0A3Q1ANM8_BOK-01      ccttcctggctgtcgctgcagatattttctccacaggtg---tgacatgg
A0A3Q1CTC5_BAX-01      tcttcatgaaggtcgccaggagcatctttgctgatggaa---ttaactgg
A0A3Q1CKY3_BAX-01      tgtttctgaaagttgctgttgagatcttttcagatggaaaatttaactgg
                         **  *    ** **       ** **  *    **     * *  ***

A0A3Q1AZQ5_BOK-01      ggtaaggtggtatccatgtacgcagtagctggagccctggcagtcgactg
A0A3Q1ANM8_BOK-01      gggaaggtggtttccctgtacgctgtggcaggagctctggcggtggactg
A0A3Q1CTC5_BAX-01      ggtcgagtggtggctctctttcatctggcctacagacttatatacaaggc
A0A3Q1CKY3_BAX-01      ggcagggtagttgcgctgttctactttgcctgtcgactcgtcattaaggc
                       **    ** **  *  * *      * **       **        *   

A0A3Q1AZQ5_BOK-01      tgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgg
A0A3Q1ANM8_BOK-01      tgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgg
A0A3Q1CTC5_BAX-01      tctgactaccaaccatttagagaacatcagaatggttatcagctgggttc
A0A3Q1CKY3_BAX-01      tcttgtaacccaagttcctgatatcatcagaaccattattcattggacca
                       * *            *      *   *    *   *  *     *     

A0A3Q1AZQ5_BOK-01      gacagtttgttcgcaaattcctggttccctggctgaaaagacgaggagga
A0A3Q1ANM8_BOK-01      gggagtttgtccgcaagagtctgacctcctggttaaagaggagaggaggc
A0A3Q1CTC5_BAX-01      tccaagtcattagagagcagctctatgcctggcttgtgcagcagggaggc
A0A3Q1CKY3_BAX-01      tggactacctccgggaacatgtgatcaactggatcagggagcaaggtggc
                          *     *  *  *     *      **** *          ** ** 

A0A3Q1AZQ5_BOK-01      tgggctgagattacaaaatgtgtggtgaagaaggatctcacccctgaaca
A0A3Q1ANM8_BOK-01      tgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttc
A0A3Q1CTC5_BAX-01      tgggagggggtgatccg------------------------tagcttttc
A0A3Q1CKY3_BAX-01      tgggagggtattcgttc--------ccactt----------cggcactcc
                       ****  *   *                                       

A0A3Q1AZQ5_BOK-01      aaactggttctcctctactgtggagtctctcacgtacttcctgaccacaa
A0A3Q1ANM8_BOK-01      tcactggctggtgtctgctgtctttgcctttggacactacctgaaggccg
A0A3Q1CTC5_BAX-01      tcgatgg---aggacagcagccatagtagcatcagtcgtactggtggcaa
A0A3Q1CKY3_BAX-01      cacatgg---cagacagtgggagttttcttggcaggcgttc------tca
                           ***       *    *                *   *         

A0A3Q1AZQ5_BOK-01      tgtacgtctacatcatgaaggagccgtga
A0A3Q1ANM8_BOK-01      tcgtgttgtacctcctcagggagaagtga
A0A3Q1CTC5_BAX-01      cttttgtttatctcaggaggacacgctga
A0A3Q1CKY3_BAX-01      ccactgttcttgtcattcgcaagatgtga
                             *     **            ***

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice