Dataset for CDS BCL-2-like of organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5MT36_BCL2-03      atggctcatcccaggc----------------------------------
A0A8C5MT36_BCL2-01      atggctcatcccaggc----------------------------------
A0A8C5MT36_BCL2-02      atggctcatcccaggc----------------------------------
A0A8C5MT36_BCL2-04      atggctcatcccaggc----------------------------------
A0A8C5QRL7_MCL1-01      atgaat--------------------------------------------
A0A8C5WFB8_BCL2L1-      atg-----------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A8C5PJK5_MCL1-01      atgtgcacgtgcacgctaatggagaggggttcaaggtgggcagggccaga
                                                                          

A0A8C5MT36_BCL2-03      -----gagcggggtacgaccaccggga------catagtggtaaaatata
A0A8C5MT36_BCL2-01      -----gagcggggtacgaccaccggga------catagtggtaaaatata
A0A8C5MT36_BCL2-02      -----gagcggggtacgaccaccggga------catagtggtaaaatata
A0A8C5MT36_BCL2-04      -----gagcggggtacgaccaccggga------catagtggtaaaatata
A0A8C5QRL7_MCL1-01      -----ggggccgg-------------------------------------
A0A8C5WFB8_BCL2L1-      -----gaaggtg----gaaataagaac-----------------------
A0A8C5PJB3_BCL2L2-      cc---ggggctgccccgagcttcggac----------------ctaggct
A0A8C5PJK5_MCL1-01      ccagaggggctggcttaagcgcagggccgccatgagagcgaagccaggca
                             *     *                                      

A0A8C5MT36_BCL2-03      ttcattataagctatcacagaggggctatgaatgggaagatgggaggcag
A0A8C5MT36_BCL2-01      ttcattataagctatcacagaggggctatgaatgggaagatgggaggcag
A0A8C5MT36_BCL2-02      ttcattataagctatcacagaggggctatgaatgggaagatgggaggcag
A0A8C5MT36_BCL2-04      ttcattataagctatcacagaggggctatgaatgggaagatgggaggcag
A0A8C5QRL7_MCL1-01      -----------gcattttgtggtggcc-----------------------
A0A8C5WFB8_BCL2L1-      ---------------ctcgtgcaaaattttgtatg---------------
A0A8C5PJB3_BCL2L2-      ctcg-------tcccttggtggaggattttgttcgg--------------
A0A8C5PJK5_MCL1-01      ccctccttcactcgctacgagaaggctatggatggattcccggccctgtg
                                                                          

A0A8C5MT36_BCL2-03      caggtttctgttgatcttcaggatgcttctg----------------ctg
A0A8C5MT36_BCL2-01      caggtttctgttgatcttcaggatgcttctg----------------ctg
A0A8C5MT36_BCL2-02      caggtttctgttgatcttcaggatgcttctg----------------ctg
A0A8C5MT36_BCL2-04      caggtttctgttgatcttcaggatgcttctg----------------ctg
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C5WFB8_BCL2L1-      ---------------------------taagaa-----------------
A0A8C5PJB3_BCL2L2-      ---------------------------tataaa-----------------
A0A8C5PJK5_MCL1-01      cttccccctgatcacttcaataaagtttataaaaggcaaccaaacgccgt
                                                                          

A0A8C5MT36_BCL2-03      ctaataataatcattctgatggtgacgaagtgtccgcttcacctggagat
A0A8C5MT36_BCL2-01      ctaataataatcattctgatggtgacgaagtgtccgcttcacctggagat
A0A8C5MT36_BCL2-02      ctaataataatcattctgatggtgacgaagtgtccgcttcacctggagat
A0A8C5MT36_BCL2-04      ctaataataatcattctgatggtgacgaagtgtccgcttcacctggagat
A0A8C5QRL7_MCL1-01      ------------------------------gggctgttttgtg-------
A0A8C5WFB8_BCL2L1-      ------attgtccca---------------gagagatttcacatgga---
A0A8C5PJB3_BCL2L2-      --------------------------------------ttaca-------
A0A8C5PJK5_MCL1-01      cttacggctgtctcaccaatgtcgtgaaagggcagcttttaca-------
                                                              *           

A0A8C5MT36_BCL2-03      ccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtc
A0A8C5MT36_BCL2-01      ccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtc
A0A8C5MT36_BCL2-02      ccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtc
A0A8C5MT36_BCL2-04      ccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtc
A0A8C5QRL7_MCL1-01      -----------atggcagaggg-------acatgttg-------------
A0A8C5WFB8_BCL2L1-      --------attgctgcacagac-----tcacattctgaggtt--------
A0A8C5PJB3_BCL2L2-      -----------ccagcgtgggttagtgtcagaacctg-------------
A0A8C5PJK5_MCL1-01      -----------gcagcagagagagacgccgcacgctgcctct--------
                                       *               *   **             

A0A8C5MT36_BCL2-03      aaataatgcatcccaaaataatgcccccaccgctcttttagacaatgcac
A0A8C5MT36_BCL2-01      aaataatgcatcccaaaataatgcccccaccgctcttttagacaatgcac
A0A8C5MT36_BCL2-02      aaataatgcatcccaaaataatgcccccaccgctcttttagacaatgcac
A0A8C5MT36_BCL2-04      aaataatgcatcccaaaataatgcccccaccgctcttttagacaatgcac
A0A8C5QRL7_MCL1-01      ---------------------------------ttt--------------
A0A8C5WFB8_BCL2L1-      ------------------------------ctatctaatgggacatctcc
A0A8C5PJB3_BCL2L2-      ----------------------------------tt--------------
A0A8C5PJK5_MCL1-01      ------------------------------cgcttt--------------
                                                           *              

A0A8C5MT36_BCL2-03      ctgctgctcagaggagctctgcttctgctgcttctaccgtcccttcacca
A0A8C5MT36_BCL2-01      ctgctgctcagaggagctctgcttctgctgcttctaccgtcccttcacca
A0A8C5MT36_BCL2-02      ctgctgctcagaggagctctgcttctgctgcttctaccgtcccttcacca
A0A8C5MT36_BCL2-04      ctgctgctcagaggagctctgcttctgctgcttctaccgtcccttcacca
A0A8C5QRL7_MCL1-01      --g------agtggagctttattgcgtt----------------------
A0A8C5WFB8_BCL2L1-      tgg------ggagcagcctgccgcacgc----------------------
A0A8C5PJB3_BCL2L2-      ------------ggagccccatcat-gc----------------------
A0A8C5PJK5_MCL1-01      ------------gcggccactccctcgc----------------------
                                    *  **                                 

A0A8C5MT36_BCL2-03      cagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgc
A0A8C5MT36_BCL2-01      cagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgc
A0A8C5MT36_BCL2-02      cagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgc
A0A8C5MT36_BCL2-04      cagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgc
A0A8C5QRL7_MCL1-01      ------------------tctcctggatattc-------ccc--------
A0A8C5WFB8_BCL2L1-      ------------------gcaggaggacattctggaagcact--------
A0A8C5PJB3_BCL2L2-      ------------------gcgct---ccattc------agcc--------
A0A8C5PJK5_MCL1-01      ------------------acgcccggccactc------cccc--------
                                           *        * **                  

A0A8C5MT36_BCL2-03      aaatcaattagtggatggcgatggagaggatgctcttgtacgaccagttc
A0A8C5MT36_BCL2-01      aaatcaattagtggatggcgatggagaggatgctcttgtacgaccagttc
A0A8C5MT36_BCL2-02      aaatcaattagtggatggcgatggagaggatgctcttgtacgaccagttc
A0A8C5MT36_BCL2-04      aaatcaattagtggatggcgatggagaggatgctcttgtacgaccagttc
A0A8C5QRL7_MCL1-01      ----------atgttt-----tgcagtatttgccccccctctcgt-----
A0A8C5WFB8_BCL2L1-      ----------gaaagtgaagctgtcctgcaagctctgctggacgc-----
A0A8C5PJB3_BCL2L2-      ----------atgcgtgccgctgg--------------------------
A0A8C5PJK5_MCL1-01      ----------gcgcttaaaactggttggcttgcagtttcccgcgctgtct
                                       *     **                           

A0A8C5MT36_BCL2-03      cccaagcggttctccagactcttagccgagcaggcgatgagttttcccgg
A0A8C5MT36_BCL2-01      cccaagcggttctccagactcttagccgagcaggcgatgagttttcccgg
A0A8C5MT36_BCL2-02      cccaagcggttctccagactcttagccgagcaggcgatgagttttcccgg
A0A8C5MT36_BCL2-04      cccaagcggttctccagactcttagccgagcaggcgatgagttttcccgg
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C5WFB8_BCL2L1-      -ctcagag--------gagtttgagctgaga-------------------
A0A8C5PJB3_BCL2L2-      ----agat--------gaatttga----aga------------------c
A0A8C5PJK5_MCL1-01      gctcagat--------cattatca----agatggaggcaggaaaggtggc
                                                                          

A0A8C5MT36_BCL2-03      ctgtaccagcaagactttaggcagata----------------------t
A0A8C5MT36_BCL2-01      ctgtaccagcaagactttaggcagata----------------------t
A0A8C5MT36_BCL2-02      ctgtaccagcaagactttaggcagata----------------------t
A0A8C5MT36_BCL2-04      ctgtaccagcaagactttaggcagata----------------------t
A0A8C5QRL7_MCL1-01      --ttccctggtggtctctcgtg----------------------------
A0A8C5WFB8_BCL2L1-      ---tatcagcgggcgtttagtgacctg----------------------a
A0A8C5PJB3_BCL2L2-      cgtttccgtcaggccttcagcgaaata----------------------t
A0A8C5PJK5_MCL1-01      tgttgcgat--ggcactgagagaaaaagaggtgcaggaagatgccgcagg
                           *        *      *                              

A0A8C5MT36_BCL2-03      ccgggctcctccacttaaccccatcaacagttc-gtccacggttt-----
A0A8C5MT36_BCL2-01      ccgggctcctccacttaaccccatcaacagttc-gtccacggttt-----
A0A8C5MT36_BCL2-02      ccgggctcctccacttaaccccatcaacagttc-gtccacggttt-----
A0A8C5MT36_BCL2-04      ccgggctcctccacttaaccccatcaacagttc-gtccacggttt-----
A0A8C5QRL7_MCL1-01      ------------ccgtcgcgtttcgctcaggct--tgcacattacat---
A0A8C5WFB8_BCL2L1-      cctcccagttgcacatcacccctgagacggcat-atcagagcttc-----
A0A8C5PJB3_BCL2L2-      ctactcagatccacgtcacgcctggcacggcat-atgcgcgcttc-----
A0A8C5PJK5_MCL1-01      ctacggggacacctgccgagccccggagagcatcatgcaggcctcaaatg
                                                     *     *              

A0A8C5MT36_BCL2-03      ----gctgctgtggtggaggaac----------tcttccatgatggggtg
A0A8C5MT36_BCL2-01      ----gctgctgtggtggaggaac----------tcttccatgatggggtg
A0A8C5MT36_BCL2-02      ----gctgctgtggtggaggaac----------tcttccatgatggggtg
A0A8C5MT36_BCL2-04      ----gctgctgtggtggaggaac----------tcttccatgatggggtg
A0A8C5QRL7_MCL1-01      ----gaagctgctgtacaagggc---------------------------
A0A8C5WFB8_BCL2L1-      ----gagcaggtcgtgggggagc----------tgtttagagatgggaca
A0A8C5PJB3_BCL2L2-      ----gcagaggtggctggaggtc----------ttttccaaggtggggtg
A0A8C5PJK5_MCL1-01      ccgagaagaaggagagagaggaccacggggacacctaccaggcccaggag
                            *     *  *     *  *                           

A0A8C5MT36_BCL2-03      aact----------------------------------------------
A0A8C5MT36_BCL2-01      aact----------------------------------------------
A0A8C5MT36_BCL2-02      aact----------------------------------------------
A0A8C5MT36_BCL2-04      aact----------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C5WFB8_BCL2L1-      aact----------------------------------------------
A0A8C5PJB3_BCL2L2-      aact----------------------------------------------
A0A8C5PJK5_MCL1-01      aactccatgcaatcctcagaggccgagagagagggtgaggagggccctga
                                                                          

A0A8C5MT36_BCL2-03      -------------------------------------------------g
A0A8C5MT36_BCL2-01      -------------------------------------------------g
A0A8C5MT36_BCL2-02      -------------------------------------------------g
A0A8C5MT36_BCL2-04      -------------------------------------------------g
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C5WFB8_BCL2L1-      -------------------------------------------------g
A0A8C5PJB3_BCL2L2-      -------------------------------------------------g
A0A8C5PJK5_MCL1-01      aaccaccagagacacctgtcagacccaagagaaccccatgcaaccctcag
                                                                          

A0A8C5MT36_BCL2-03      gggaagga--------------ttgtggctttctttgagtttggaggtgt
A0A8C5MT36_BCL2-01      gggaagga--------------ttgtggctttctttgagtttggaggtgt
A0A8C5MT36_BCL2-02      gggaagga--------------ttgtggctttctttgagtttggaggtgt
A0A8C5MT36_BCL2-04      gggaagga--------------ttgtggctttctttgagtttggaggtgt
A0A8C5QRL7_MCL1-01      ----------------------cggcggtgtctgtgccgaccagctccgc
A0A8C5WFB8_BCL2L1-      ggggcgaa--------------tcgtagctttcttctcatttggaggggc
A0A8C5PJB3_BCL2L2-      gggccgcg--------------tggtggcattctttgtgtttggagctgc
A0A8C5PJK5_MCL1-01      aggccgagagagaggagggccctgaaagcacctgtcaggcccagaagtgc
                                                   *      *        *    * 

A0A8C5MT36_BCL2-03      catgtg--------------------------------------------
A0A8C5MT36_BCL2-01      catgtg--------------------------------------------
A0A8C5MT36_BCL2-02      catgtg--------------------------------------------
A0A8C5MT36_BCL2-04      catgtg--------------------------------------------
A0A8C5QRL7_MCL1-01      tacatggca-----------------------------------------
A0A8C5WFB8_BCL2L1-      cctctg--------------------------------------------
A0A8C5PJB3_BCL2L2-      tctctg--------------------------------------------
A0A8C5PJK5_MCL1-01      ttcttggagacctcagaggccctggaggagagacaaggtgaggagagccc
                            **                                            

A0A8C5MT36_BCL2-03      -----------------------------cgtggag--------------
A0A8C5MT36_BCL2-01      -----------------------------cgtggag--------------
A0A8C5MT36_BCL2-02      -----------------------------cgtggag--------------
A0A8C5MT36_BCL2-04      -----------------------------cgtggag--------------
A0A8C5QRL7_MCL1-01      -----------------------------tgctgac--------------
A0A8C5WFB8_BCL2L1-      -----------------------------tgtcgaa--------------
A0A8C5PJB3_BCL2L2-      -----------------------------tgcggaa--------------
A0A8C5PJK5_MCL1-01      tgaagacagcacagacacctgtcagtccctgcagaacttcttggagtctt
                                                      *  **               

A0A8C5MT36_BCL2-03      --------------------------agtgtgaatcgggagatg------
A0A8C5MT36_BCL2-01      --------------------------agtgtgaatcgggagatg------
A0A8C5MT36_BCL2-02      --------------------------agtgtgaatcgggagatg------
A0A8C5MT36_BCL2-04      --------------------------agtgtgaatcgggagatg------
A0A8C5QRL7_MCL1-01      -------------------------------------gaagctg------
A0A8C5WFB8_BCL2L1-      --------------------------agcgtccacaaggagatggaag--
A0A8C5PJB3_BCL2L2-      --------------------------agtgttaacaaggagatgg-----
A0A8C5PJK5_MCL1-01      cagaggccgaacaggaggaggaggatagagatgacaaaaagatggaggct
                                                               ** **      

A0A8C5MT36_BCL2-03      ---------------------tcacc------------------------
A0A8C5MT36_BCL2-01      ---------------------tcacc------------------------
A0A8C5MT36_BCL2-02      ---------------------tcacc------------------------
A0A8C5MT36_BCL2-04      ---------------------tcacc------------------------
A0A8C5QRL7_MCL1-01      --------------------tctatc---------------cag------
A0A8C5WFB8_BCL2L1-      ----------------atctgttgcc------------------------
A0A8C5PJB3_BCL2L2-      -------------ctcgacttctacc--------------gcaga-----
A0A8C5PJK5_MCL1-01      gatgtcccggggcccagtcctccgcctgaggatccgcagtgcagacagga
                                                 *                        

A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A8C5QRL7_MCL1-01      ------------------------------------------caag----
A0A8C5WFB8_BCL2L1-      ------------------------------------------tagg--at
A0A8C5PJB3_BCL2L2-      ----------------------------------------ttcagg----
A0A8C5PJK5_MCL1-01      cgagctcttcctttactcccgcctgctgctcctaaccttcttcagggagt
                                                                          

A0A8C5MT36_BCL2-03      --actggtggac--------------------------------------
A0A8C5MT36_BCL2-01      --actggtggac--------------------------------------
A0A8C5MT36_BCL2-02      --actggtggac--------------------------------------
A0A8C5MT36_BCL2-04      --actggtggac--------------------------------------
A0A8C5QRL7_MCL1-01      ----cggaggat--------------------------------------
A0A8C5WFB8_BCL2L1-      tgtccagtggat-------------------------------gaccacc
A0A8C5PJB3_BCL2L2-      -----agtggat-------------------------------ggtgacc
A0A8C5PJK5_MCL1-01      atgccggtggaccagacccgggcccagtgagggctctcatccagctggcc
                              * ***                                       

A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A8C5QRL7_MCL1-01      ---ctccagaagctctc---------------------------------
A0A8C5WFB8_BCL2L1-      tatctggataatcagtt-----------------------ggaagactgg
A0A8C5PJB3_BCL2L2-      tatcttgaaacgcacct-----------------------gagagactgg
A0A8C5PJK5_MCL1-01      atgcccaacacggccctgcagaccctactgagggtggcgagagagacc--
                                                                          

A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A8C5QRL7_MCL1-01      ------------------tg---------------aggtgcctt------
A0A8C5WFB8_BCL2L1-      atccaaacgaacgaaggctg---------------ggaagcatt------
A0A8C5PJB3_BCL2L2-      atgcagagcaatggtggatg---------------gaatggatt------
A0A8C5PJK5_MCL1-01      atagagaggaaccacgcatgcttccagaacaccctgaacaggctttgcat
                                                                          

A0A8C5MT36_BCL2-03      -------------------------------------------------t
A0A8C5MT36_BCL2-01      -------------------------------------------------t
A0A8C5MT36_BCL2-02      -------------------------------------------------t
A0A8C5MT36_BCL2-04      -------------------------------------------------t
A0A8C5QRL7_MCL1-01      ---------------------------------------ccttggtctt-
A0A8C5WFB8_BCL2L1-      ---------------------------------------cgtgcgccttt
A0A8C5PJB3_BCL2L2-      ---------------------------------------cctggctctat
A0A8C5PJK5_MCL1-01      tgagaggccagaacacctgcagaagctctccctggtaaccttcgcactgt
                                                                          

A0A8C5MT36_BCL2-03      ccatcgttggttggatga--------------------------------
A0A8C5MT36_BCL2-01      ccatcgttggttggatga--------------------------------
A0A8C5MT36_BCL2-02      ccatcgttggttggatga--------------------------------
A0A8C5MT36_BCL2-04      ccatcgttggttggatga--------------------------------
A0A8C5QRL7_MCL1-01      -caacgatgggatcacaaattggggcaggattgtgacattaattagcttt
A0A8C5WFB8_BCL2L1-      acgggaatgatgcagctgccagcagcag----------------------
A0A8C5PJB3_BCL2L2-      atggcgatggtgctata---------------------------------
A0A8C5PJK5_MCL1-01      tcagtgatggtgccatcaactggggcagaatcgccaccctgttcagcttc
                               **                                         

A0A8C5MT36_BCL2-03      -------------cagagtacctgaatag---------------------
A0A8C5MT36_BCL2-01      -------------cagagtacctgaatag---------------------
A0A8C5MT36_BCL2-02      -------------cagagtacctgaatag---------------------
A0A8C5MT36_BCL2-04      -------------cagagtacctgaatag---------------------
A0A8C5QRL7_MCL1-01      ggcgctttccttgcaaaacatttgcagagcataaaactggaggactgtat
A0A8C5WFB8_BCL2L1-      -----------------------gaaaag---------------------
A0A8C5PJB3_BCL2L2-      -----------------------gaagag---------------------
A0A8C5PJK5_MCL1-01      accgccctcgtggcccgacacctgaagaacctagggatgaatgacagcat
                                               * * *                      

A0A8C5MT36_BCL2-03      -----------------gcatct----------------------gcaaa
A0A8C5MT36_BCL2-01      -----------------gcatct----------------------gcaaa
A0A8C5MT36_BCL2-02      -----------------gcatct----------------------gcaaa
A0A8C5MT36_BCL2-04      -----------------gcatct----------------------gcaaa
A0A8C5QRL7_MCL1-01      cgttccactggcagataatttcacggattaccttatgaccagcaaacggg
A0A8C5WFB8_BCL2L1-      --------tcaggaac-gcttcggccgat---------------------
A0A8C5PJB3_BCL2L2-      ------gctcgaagacagcgt---------------------gaagggaa
A0A8C5PJK5_MCL1-01      ctttacgctcgcagacggcgtcgcccgattcctcaccatcaccaagagaa
                                            *                             

A0A8C5MT36_BCL2-03      actggatccaggaacaaggcggatgg------ttaaacacattgcctgag
A0A8C5MT36_BCL2-01      actggatccaggaacaaggcggatgggagtcgtttgtggaattgtatgac
A0A8C5MT36_BCL2-02      actggatccaggaacaaggcggatgg------------------------
A0A8C5MT36_BCL2-04      actggatccaggaacaaggcggatgg--------tgctgggcttccttag
A0A8C5QRL7_MCL1-01      aatggattatgcaacaaaaaagctgggatggttttgtagagtttttccac
A0A8C5WFB8_BCL2L1-      ---ggcttct----------gactggg-----------------------
A0A8C5PJB3_BCL2L2-      ttgggcctca-----ctgaagactg---------------------ttct
A0A8C5PJK5_MCL1-01      gctggttccaggaacatcaaggctgggacggttttgtggagttcttcctt
                           **                  **                         

A0A8C5MT36_BCL2-03      attgagacgctgcagagtcttattcga--------gaaacacagagatca
A0A8C5MT36_BCL2-01      agcagcgtcagac---ccccatttgaccccagttggatctccatcaa--g
A0A8C5MT36_BCL2-02      -------------gtgtcatttttcaaccttttcta--------cat---
A0A8C5MT36_BCL2-04      agctggttcagacaggacatgcttcgactccctgtaagctgcagcatttg
A0A8C5QRL7_MCL1-01      gttgaggactatgaaagcggactcagaactgttctg-----------atg
A0A8C5WFB8_BCL2L1-      gtca--cgctggc----------tggaattatcctg-----------ctt
A0A8C5PJB3_BCL2L2-      gacaggcgcagtc------gccttggg--tgctctg-----------atg
A0A8C5PJK5_MCL1-01      gtcagtcgctggcaaaccggcatcaggattgccctg-----------ttg
                                                                          

A0A8C5MT36_BCL2-03      ttgcgtcagtcccacagaaagaatgaatgcacctggataaagagagcgca
A0A8C5MT36_BCL2-01      acaatactgagtcttgctgtggttggagcctgcatcaccataggagcata
A0A8C5MT36_BCL2-02      acacttcctggtc------------gaggc--ctcatttatagatgctca
A0A8C5MT36_BCL2-04      acatggccgtggc------------gaggcagccaatcaaattactctca
A0A8C5QRL7_MCL1-01      acctttgccggagttgctggaatcggagcaagtcttgcctat-atgatcc
A0A8C5WFB8_BCL2L1-      att-------------------------------tcctacatggcccgca
A0A8C5PJB3_BCL2L2-      aca------------gtgggag------------ctctgttt-gccagca
A0A8C5PJK5_MCL1-01      gcactcgctatctttgcaggaatcgccacaagcctcctgtac-cttatca
                                                                          

A0A8C5MT36_BCL2-03      gaggattttgacacattcttga
A0A8C5MT36_BCL2-01      ----ccttggtcaca--agtga
A0A8C5MT36_BCL2-02      ----a--------------tga
A0A8C5MT36_BCL2-04      ----aggccgaacac--attga
A0A8C5QRL7_MCL1-01      -----------------ggtga
A0A8C5WFB8_BCL2L1-      -----------------gatag
A0A8C5PJB3_BCL2L2-      -----------------agtga
A0A8C5PJK5_MCL1-01      -----------------tgtga
                                           *  

© 1998-2022Legal notice