Dataset for CDS BCL-2 of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3MEY1_BCL2-01      atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataa
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-05      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcat
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q3MEY1_BCL2-01      actctccaaacg-------------------cggctacgtgtgg----gg
A0A3Q3MEY1_BCL2-02      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-10      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-08      -------------------------------actcatctattgg------
A0A3Q3MEY1_BCL2-04      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-05      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-07      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-09      -------------------------------atgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-03      caactcctggtggctccttcttcccttcatcatgcttcttgtagttgccg
A0A3Q3MEY1_BCL2-06      -------------------------------atgcttcttgtagttgccg
                                                          *  *   * *      

A0A3Q3MEY1_BCL2-01      atttcataacgtccaggatgaagatgctgctaataatg--gctctgtagt
A0A3Q3MEY1_BCL2-02      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-10      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-08      -----------acctttgggtt---------tatgatct-----------
A0A3Q3MEY1_BCL2-04      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-05      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-07      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-09      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-03      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
A0A3Q3MEY1_BCL2-06      ccttcattgttgcctttgtgttgctgttatatatgatatcgccccttatt
                                    **     *            ** **             

A0A3Q3MEY1_BCL2-01      tgccc-----ctccg---ccgactgtggtccgc----cggtgccgtgacg
A0A3Q3MEY1_BCL2-02      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-10      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-08      ---cctgactcttttgaact--------------ttcaggtgacaggagg
A0A3Q3MEY1_BCL2-04      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-05      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-07      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-09      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-03      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
A0A3Q3MEY1_BCL2-06      agccccaaacctctgaaactgaacggggcccacgtcgtggtgacaggagg
                           **     **      *                   **** *  ** *

A0A3Q3MEY1_BCL2-01      c-----------------gagcaccgggcccgacagcga--------gag
A0A3Q3MEY1_BCL2-02      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-10      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-08      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-04      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-05      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-07      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-09      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-03      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
A0A3Q3MEY1_BCL2-06      ctcaagtggaattgggaagtgcatcgcgatcgagtgctacaggcaaggag
                        *                 * *** ** *  ***  ** *        ***

A0A3Q3MEY1_BCL2-01      catccccca--------gctctgcagagggctccctcagtccgaccca--
A0A3Q3MEY1_BCL2-02      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-10      cgttcatcactctggtggcacgagatgagcctg-gttgtct---------
A0A3Q3MEY1_BCL2-08      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-04      cgttcatcactctggtggcacgagatgagccgatgccatttaacttaagg
A0A3Q3MEY1_BCL2-05      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-07      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-09      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-03      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
A0A3Q3MEY1_BCL2-06      cgttcatcactctggtggcacgagatgagactaagttgcttcaagcaa--
                        * * *  **        ** *   *   * *                   

A0A3Q3MEY1_BCL2-01      ------------------caagccgccattca-----------cagagtc
A0A3Q3MEY1_BCL2-02      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
A0A3Q3MEY1_BCL2-04      tttcataagactgtgtacaatttcttaatt---------caggtggtgct
A0A3Q3MEY1_BCL2-05      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtatgggt
A0A3Q3MEY1_BCL2-07      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
A0A3Q3MEY1_BCL2-09      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
A0A3Q3MEY1_BCL2-03      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
A0A3Q3MEY1_BCL2-06      ----aaaaagaggtggagaaatttgccattaatgacaagcaggtggtgct
                                                                          

A0A3Q3MEY1_BCL2-01      ctgcgcgaggctgga----------------gatgaacttgaaagactg-
A0A3Q3MEY1_BCL2-02      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-10      ---------------------------ttatagccaggtgaaaa------
A0A3Q3MEY1_BCL2-08      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-04      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-05      tt--atttgagtaga-------agtgacttttttgctgt------tgtg-
A0A3Q3MEY1_BCL2-07      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-09      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-03      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
A0A3Q3MEY1_BCL2-06      ctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtga
                                                              *           

A0A3Q3MEY1_BCL2-01      --------------tatcagccggactttacggaga-------------t
A0A3Q3MEY1_BCL2-02      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-10      ------acgctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-08      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-04      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-05      -----caggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-07      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-09      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-03      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
A0A3Q3MEY1_BCL2-06      taaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgt
                                       *  *** **    *   ** *             *

A0A3Q3MEY1_BCL2-01      gtcgcgacagctgtatctcacctccaccacggcgcagaggcgattcgccg
A0A3Q3MEY1_BCL2-02      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-10      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-08      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-04      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-05      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-07      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-09      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-03      gctggaacatctgtttct-------------------ggaaagtttgagg
A0A3Q3MEY1_BCL2-06      gctggaacatctgtttct-------------------ggaaagtttgagg
                        *  *  *** **** ***                    *    ** *  *

A0A3Q3MEY1_BCL2-01      aggtgatagatgaactgttccgggac-------ggggtgaactg------
A0A3Q3MEY1_BCL2-02      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-10      aagtgg-aggtggaccgttttaaa--------------------------
A0A3Q3MEY1_BCL2-08      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-04      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-05      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-07      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-09      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-03      aagtgg-aggtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A3Q3MEY1_BCL2-06      aagtgg-aggtggaccgttttaaa--------------------------
                        * ***  ** ** ** ***                               

A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-04      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-05      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-07      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-09      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-03      cagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaa
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q3MEY1_BCL2-01      -gggccggatta---tcgctttcttcga------------------gttc
A0A3Q3MEY1_BCL2-02      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-04      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-05      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-07      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-09      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-03      tgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgttt
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q3MEY1_BCL2-01      ggcggcaccgtgt-------------gcgtggagtgcgcggccaaggagg
A0A3Q3MEY1_BCL2-02      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-04      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-05      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-07      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-09      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-03      ggatacactgcatactccccatccaagtttgccctgcgaggcttggcaga
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
                                                                          

A0A3Q3MEY1_BCL2-01      --------agatgacatcgcaagtggacaacatc----------------
A0A3Q3MEY1_BCL2-02      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-04      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-05      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-07      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-09      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-03      gtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcct
A0A3Q3MEY1_BCL2-06      ----------------ataaagccgtacaacatctatgtgaccgtggcct
                                                                          

A0A3Q3MEY1_BCL2-01      --------------------------------gcggagtggatgacggag
A0A3Q3MEY1_BCL2-02      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-04      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-05      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-07      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-09      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-03      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
A0A3Q3MEY1_BCL2-06      acccgccagacacagacactccaggattggctgaggaaaataagacaaag
                                                                          

A0A3Q3MEY1_BCL2-01      tattt-------aaatggacctctt-aacagctgg---------------
A0A3Q3MEY1_BCL2-02      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-04      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-05      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-07      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-09      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-03      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
A0A3Q3MEY1_BCL2-06      cctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccaga
                                                                          

A0A3Q3MEY1_BCL2-01      -------------------atacaagata----acggggga---------
A0A3Q3MEY1_BCL2-02      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-04      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-05      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-07      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-09      gcaagtggccaaaattgttgtgcgagatgca-------------------
A0A3Q3MEY1_BCL2-03      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
A0A3Q3MEY1_BCL2-06      gcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaaca
                                                                          

A0A3Q3MEY1_BCL2-01      ------tggga---------------------------------------
A0A3Q3MEY1_BCL2-02      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-04      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-05      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-07      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
A0A3Q3MEY1_BCL2-06      gttccgtgggacctgatggttacatgctctctgccctcacctgtggaatg
                                                                          

A0A3Q3MEY1_BCL2-01      --------------------------------------tgcctttgtgga
A0A3Q3MEY1_BCL2-02      tcacctgtcacgtccatcacagaagctctccagcaggatgcctttgtgga
A0A3Q3MEY1_BCL2-10      ------------------------------------attattaccatgg-
A0A3Q3MEY1_BCL2-08      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
A0A3Q3MEY1_BCL2-04      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
A0A3Q3MEY1_BCL2-05      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
A0A3Q3MEY1_BCL2-07      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
A0A3Q3MEY1_BCL2-09      ------------------------------------attattaccatgg-
A0A3Q3MEY1_BCL2-03      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
A0A3Q3MEY1_BCL2-06      tcacctgtcacgtccatcacagaagctctccagcagattattaccatgg-
                                                              *       *** 

A0A3Q3MEY1_BCL2-01      gatgtatgacaggcagagggagtctgtcttcagttgttcctggccctcca
A0A3Q3MEY1_BCL2-02      gatgtatgacaggcagagggagtctgtcttcagttgttcctggccctcca
A0A3Q3MEY1_BCL2-10      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-08      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-04      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-05      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-07      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-09      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-03      -------------------------------ggttatttcggaccatc--
A0A3Q3MEY1_BCL2-06      -------------------------------ggttatttcggaccatc--
                                                        *** ** * * ** **  

A0A3Q3MEY1_BCL2-01      tcaaaacagtcttcggcctgg----------ctgcacttggggcagctag
A0A3Q3MEY1_BCL2-02      tcaaaacagtcttcggcctgg----------ctgcacttggggcagctag
A0A3Q3MEY1_BCL2-10      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-08      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-04      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-05      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-07      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-09      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-03      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
A0A3Q3MEY1_BCL2-06      -----gccctcttctacctggggagttttgacagcattgtacgccgct-g
                              *  *****  *****          * *** *    ** *** *

A0A3Q3MEY1_BCL2-01      cattact--atcggagcat--------accttaca--cagaagtga
A0A3Q3MEY1_BCL2-02      cattact--atcggagcat--------accttaca--cagaagtga
A0A3Q3MEY1_BCL2-10      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
A0A3Q3MEY1_BCL2-08      catgattcagagggagcat---gacacagctcttc------cgtag
A0A3Q3MEY1_BCL2-04      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
A0A3Q3MEY1_BCL2-05      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
A0A3Q3MEY1_BCL2-07      catgattcagagggagcat---gacacagctcttc------cgtag
A0A3Q3MEY1_BCL2-09      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
A0A3Q3MEY1_BCL2-03      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
A0A3Q3MEY1_BCL2-06      catgattcagagggagcagtcaaaatcagctgacaagagggagtaa
                        *** * *     ******         * **           **  

© 1998-2022Legal notice