Dataset for CDS BAX-like of Organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5L9Q9_BOK-01       atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggat
A0A2K5KU58_BAX-03       atggacgggtccggggagcagcccag--------aggcgggggtgaggcg
A0A2K5KU58_BAX-04       atggacgggtccggggagcagcccag--------aggcggggggcccacc
A0A2K5KTN5_BAK1-02      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
A0A2K5KTN5_BAK1-03      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
A0A2K5N1I8_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2K5N1I8_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
                            * **      *      * * *         * *  *         

A0A2K5L9Q9_BOK-01       gcctttgaccgctcgcccaccgacaaggagctggtggcccaggcca---a
A0A2K5KU58_BAX-03       gg-------------------------aggcagac-----gggc-----g
A0A2K5KU58_BAX-04       agctc---------------------tgagcagatcatgaagac-----a
A0A2K5KTN5_BAK1-02      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
A0A2K5KTN5_BAK1-03      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
A0A2K5N1I8_BAK1-02      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2K5N1I8_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
                                                     ** *        *        

A0A2K5L9Q9_BOK-01       ggcgctgggccgggagtacgt---------------gcacgcgc-ggcta
A0A2K5KU58_BAX-03       ggag------------gaggtttcatccaggatcgagcag-----ggcga
A0A2K5KU58_BAX-04       ggggcccttttgcttcagggtttcatccaggatcgagcag-----ggcga
A0A2K5KTN5_BAK1-02      gaag---------------gtttttgaccgccatcagcaagaacaggagg
A0A2K5KTN5_BAK1-03      gaag---------------gtttttgaccgccatcagcaagaacaggagg
A0A2K5N1I8_BAK1-02      ggaggttttccgcagctacgttttttaccgccatcagcaggaacaggagg
A0A2K5N1I8_BAK1-01      ggaggttttccgcagctacgttttttaccgccatcagcaggaacaggagg
                        *  *               **               ***      **   

A0A2K5L9Q9_BOK-01       ctg----------cgcgccggcctctcc-----tgga----gcgcgcccg
A0A2K5KU58_BAX-03       atggggggggagacacccgagctggccc-----tggacccggtgcctcag
A0A2K5KU58_BAX-04       atggggggggagacacccgagctggccc-----tggacccggtgcctcag
A0A2K5KTN5_BAK1-02      ctgaagggccagccgcccctgccgacccagagatggtcaccttgcccc--
A0A2K5KTN5_BAK1-03      ctgaag--------------------------------------------
A0A2K5N1I8_BAK1-02      ctgaaggggcggctgcccctgctgatccagagatggacaccttgcccc--
A0A2K5N1I8_BAK1-01      ctgaaggggcggctgcccctgctgatccagagatggacaccttgcccc--
                         **                                               

A0A2K5L9Q9_BOK-01       agcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggtgctc
A0A2K5KU58_BAX-03       gatgcgtc-------caccaagaggc----------tgagcgagtgtctc
A0A2K5KU58_BAX-04       gatgcgtc-------caccaagaggc----------tgagcgagtgtctc
A0A2K5KTN5_BAK1-02      --tccaacctagcagcaccgtggggc-------aggtgggacggcagatc
A0A2K5KTN5_BAK1-03      -----------gcagcaccgtggggc-------aggtgggacggcagatc
A0A2K5N1I8_BAK1-02      --tgcaacctagcagcaccatggggc-------aggtgggacggcagctc
A0A2K5N1I8_BAK1-01      --tgcaacctagcagcaccatggggc-------aggtgggacggcagctc
                                         **  *  **          ** *   *    **

A0A2K5L9Q9_BOK-01       ctgcgcctgggggatgagctggagatgatccggcccagcgtctaccgaaa
A0A2K5KU58_BAX-03       aagcgcatcggggacgaactggacagt---------------------aa
A0A2K5KU58_BAX-04       aagcgcatcggggacgaactggacagt---------------------aa
A0A2K5KTN5_BAK1-02      ------------------------------------------------ac
A0A2K5KTN5_BAK1-03      ------------------------------------------------ac
A0A2K5N1I8_BAK1-02      gccatcatcggggacgacatcaaccgacgctatgactcagagttccagac
A0A2K5N1I8_BAK1-01      gccatcatcggggacgacatcaaccgacgctatgactcagagttccagac
                                                                        * 

A0A2K5L9Q9_BOK-01       cgtggctcgtcagctgca----catctccctgcagtctgaacctgtggtg
A0A2K5KU58_BAX-03       catg------gagctgcagaggatgattgccgccgtggaca-cagactcc
A0A2K5KU58_BAX-04       catg------gagctgcagaggatgattgccgccgtggaca-cagactcc
A0A2K5KTN5_BAK1-02      catg------ctgcagca----------cctgcagcgcacagcagagaac
A0A2K5KTN5_BAK1-03      catg------ctgcagca----------cctgcagcgcacagcagagaac
A0A2K5N1I8_BAK1-02      catg------ctgcagca----------gctgcagcccacggcagagaac
A0A2K5N1I8_BAK1-01      catg------ctgcagca----------gctgcagcccacggcagagaac
                        * **        ** ***           * ** *       * *     

A0A2K5L9Q9_BOK-01       accgatgcgttcctggcc---gtggctgg--------------------c
A0A2K5KU58_BAX-03       ccccgagaggtctttttccgagtggcagc--------------------t
A0A2K5KU58_BAX-04       ccccgagaggtctttttccgagtggcagc--------------------t
A0A2K5KTN5_BAK1-02      gcctacgagtacttcaccaagatcgcctc--------------------c
A0A2K5KTN5_BAK1-03      gcctacgagtacttcaccaagatcgcctc--------------------c
A0A2K5N1I8_BAK1-02      gcctatgagtacttcaccaagattgcctccaggccagcagcaacacccac
A0A2K5N1I8_BAK1-01      gcctatgagtacttcaccaagattgcctc--------------------c
                         **   * *  * *   *    * **                        

A0A2K5L9Q9_BOK-01       cacatcttctctgcagg---catcacgtggggcaaggtggtgtccctgta
A0A2K5KU58_BAX-03       gacatgttttctgacggcaacttcaactggggccgtgttgtcgccct---
A0A2K5KU58_BAX-04       gacatgttttctgacggcaacttcaactggggccgtgttgtcgccct---
A0A2K5KTN5_BAK1-02      agcctgtt---tgagagtggcatcaaccagggccgtgtggtggctct---
A0A2K5KTN5_BAK1-03      agcctgtt---tgagagtggcatcaaccagggccgtgtggtggctct---
A0A2K5N1I8_BAK1-02      agcctgtt---tgagagtggcatcaactggggccgtgtggtggctct---
A0A2K5N1I8_BAK1-01      agcctgtt---tgagagtggcatcaactggggccgtgtggtggctct---
                          * * **   **   *   * ***    ****   ** **  * **   

A0A2K5L9Q9_BOK-01       tgcggtggccgcggggctggctgtggactgtgtgaggcaggcccagcctg
A0A2K5KU58_BAX-03       --------tttctactttgccagcaaactg-gtgctcaaggccctgtgta
A0A2K5KU58_BAX-04       --------tttctactttgccagcaaactg-gtgctcaaggccctgtgta
A0A2K5KTN5_BAK1-02      --------cctgggcttcagctaccatctg-gtcct-----acatgtcta
A0A2K5KTN5_BAK1-03      --------cctgggcttcagctaccatctg-gtcct-----acatgtcta
A0A2K5N1I8_BAK1-02      --------tctgggcttcggctaccgtctg-gccct-----acacgtcta
A0A2K5N1I8_BAK1-01      --------tctgggcttcggctaccgtctg-gccct-----acacgtcta
                                            *      *** *          *  *  * 

A0A2K5L9Q9_BOK-01       cca------------tggtccacgccctcgtggactgtctgggggagttt
A0A2K5KU58_BAX-03       ccaaggtgcccgaactgatcagaaccatcatgggctggacactggacttc
A0A2K5KU58_BAX-04       ccaaggtgcccgaactgatcagaaccatcatgggctggacactggacttc
A0A2K5KTN5_BAK1-02      ccagcgcggcttgactgg-------cttcctgggccaggt----gacccg
A0A2K5KTN5_BAK1-03      ccagcgcggcttgactgg-------cttcctgggccaggt----gacccg
A0A2K5N1I8_BAK1-02      ccagcacggcctga------------------------------------
A0A2K5N1I8_BAK1-01      ccagcacggcctgactgg-------cttcctgggccaggt----gacccg
                        ***                                               

A0A2K5L9Q9_BOK-01       gtgcgcaagacgctggcaa-------------------cctggctgcgga
A0A2K5KU58_BAX-03       ctccgggagcggctgttgg-------------------gctggatccaag
A0A2K5KU58_BAX-04       ctccgggagcggctgttgg-------------------gctggatccaag
A0A2K5KTN5_BAK1-02      cttcgtggt---cttcatgctgcaacactgcatcgcctggtggatcgcgc
A0A2K5KTN5_BAK1-03      cttcgtggt---cttcatgctgcaacactgcatcgcctggtggatcgcgc
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      cttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
                                                                          

A0A2K5L9Q9_BOK-01       gacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccct
A0A2K5KU58_BAX-03       accagggtggttgggacggcctcct--gtcctac-tttgggacacccacg
A0A2K5KU58_BAX-04       accagggtggttgggtgagactcctcaaccctcc-c------caccccaa
A0A2K5KTN5_BAK1-02      agaggggcagctgggtggcagccctggact------------tgggcaat
A0A2K5KTN5_BAK1-03      agaggggcagctgggtggcagccctggact------------tgggcaat
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      agaggggtggctgggtggcagccctgaact------------tgggcaat
                                                                          

A0A2K5L9Q9_BOK-01       ggcctccgctcccactggctggtagccgcactctgcagcttcggccgctt
A0A2K5KU58_BAX-03       tggcagaccgtgaccatcttggtggctggagtactcaccgcct-------
A0A2K5KU58_BAX-04       ccaccgcccctgccccact--gtccctg-----cccaccccctgtcac--
A0A2K5KTN5_BAK1-02      ggtcccatcctgaacatgctggtgattc----------------tggg--
A0A2K5KTN5_BAK1-03      ggtcccatcctgaacatgctggtgattc----------------tggg--
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      ggtcccatcctgaacgtgctggtggttc----------------tggg--
                                                                          

A0A2K5L9Q9_BOK-01       cctgaaggctgccttcttcgtgctgctgccagagagatga----------
A0A2K5KU58_BAX-03       ------------ccctcaccatc--tgga--agaagatggg---------
A0A2K5KU58_BAX-04       ---agtggtgccctctccccatctttggatcatcagatgtggtctataat
A0A2K5KTN5_BAK1-02      ---ggtggttctgttgggcccgtttgtggtacaaagat---------tct
A0A2K5KTN5_BAK1-03      ---ggtggttctgttgggcccgtttgtggtacaaagat---------tct
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      ---tgtggttctgttgggccagtttgtggtacgaagat---------tct
                                                                          

A0A2K5L9Q9_BOK-01       ------------------
A0A2K5KU58_BAX-03       -------ctga-------
A0A2K5KU58_BAX-04       gcatttccttatgtgtct
A0A2K5KTN5_BAK1-02      tcaaatcatga-------
A0A2K5KTN5_BAK1-03      tcaaatcatga-------
A0A2K5N1I8_BAK1-02      ------------------
A0A2K5N1I8_BAK1-01      tcaaatcatga-------
                                          

© 1998-2020Legal notice