Dataset for CDS MCL-1 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5DMS4_MCL1-01      at--gtttggcttccaagt--------ggtaatcagactcaacctctact
A0A2K5EPX0_MCL1-02      ag-----------ccagagttata---ataacttaaagataaccac----
A0A2K5EPX0_MCL1-01      aatgcctcatgttccagacctgcatgcttttctt--------cccc----
A0A2K5C7L5_MCL1-01      at--gtttggcctccaaag--aaacgcgctaatcggactcaacctctact
A0A2K5CFH3_MCL1-01      at--gtttggcctccaaag--aaacgcggtaatcggactcaacctctact
A0A2K5CFH3_MCL1-03      at--gtttggcctccaaag--aaacgcggtaatcggactcaacctctact
                        *            ***                *         ** *    

A0A2K5DMS4_MCL1-01      ------------------------------gcggtgccatccctccagga
A0A2K5EPX0_MCL1-02      ------atgcatgcttcgaaaac---------------------------
A0A2K5EPX0_MCL1-01      ------aggcatgcttcgaaaac---------------------------
A0A2K5C7L5_MCL1-01      gtgagtgggccggcttggggactggcagtggcggcaccacccctccggga
A0A2K5CFH3_MCL1-01      gtgggggggccggcttgggggccggcagcggcggcgccacccctccggga
A0A2K5CFH3_MCL1-03      gtgggggggccggcttgggggccggcagcggcggcgccacccctccggga
                                                                          

A0A2K5DMS4_MCL1-01      ccgcggcttttggcgactggcgccaaggac---acaaagccaatgggcag
A0A2K5EPX0_MCL1-02      ----------tggacatcaaaaacaaagac--------------------
A0A2K5EPX0_MCL1-01      ----------tggacatcaaaaacaaagac--------------------
A0A2K5C7L5_MCL1-01      gggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagg
A0A2K5CFH3_MCL1-01      gggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagg
A0A2K5CFH3_MCL1-03      gggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagg
                                  ***  *         * * *                    

A0A2K5DMS4_MCL1-01      gtctgaggccgccaac--agtaaggcgctggagaccttacga--------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gggaggggaggccggcgtggtgattggcggaagcgccggcgctagcccct
A0A2K5CFH3_MCL1-01      gggaggggaggccggcgcggtgattggcggaagcgccggcgctagccccc
A0A2K5CFH3_MCL1-03      gggaggggaggccggcgcggtgattggcggaagcgccggcgctagccccc
                                                                          

A0A2K5DMS4_MCL1-01      -----------------ggggttggggaaggcgtg---------------
A0A2K5EPX0_MCL1-02      -----------------gatgtcaaa------------------------
A0A2K5EPX0_MCL1-01      -----------------gatgtcaaa------------------------
A0A2K5C7L5_MCL1-01      cggccgccctcacgcctgacgcccgg-gggtcgtgcggccgctgc-----
A0A2K5CFH3_MCL1-01      cggccgccctcgtgcctgacgcccggagggtcgtgcggccgccgcccatt
A0A2K5CFH3_MCL1-03      cggccgccctcgtgcctgacgcccggagggtcgtgcggccgccgcccatt
                                         *  *                             

A0A2K5DMS4_MCL1-01      -----------------------------------------------ccc
A0A2K5EPX0_MCL1-02      ----------------------------------------------tctt
A0A2K5EPX0_MCL1-01      ----------------------------------------------tctt
A0A2K5C7L5_MCL1-01      ------------------------------------------tggttctt
A0A2K5CFH3_MCL1-01      ggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttctt
A0A2K5CFH3_MCL1-03      ggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttctt
                                                                       *  

A0A2K5DMS4_MCL1-01      cgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaa
A0A2K5EPX0_MCL1-02      tgt---------------------------ctcgag----tgatggtcca
A0A2K5EPX0_MCL1-01      tgt---------------------------ctcgag----tgatggtcca
A0A2K5C7L5_MCL1-01      cgcgcccac----ccgccgcgcggcgc-cgcttgaggagatggaagcccc
A0A2K5CFH3_MCL1-01      cgcgcccac----ccgccgcgcggcgc-cgcttgaggagatggaagcccc
A0A2K5CFH3_MCL1-03      cgcgcccac----ccgccgcgcggcgc-cgcttgaggagatggaagcccc
                         *                            **   *    **     *  

A0A2K5DMS4_MCL1-01      aaacgaagacaatgtcaaatctttctacggcgta----------acaaac
A0A2K5EPX0_MCL1-02      tgttttcagcgacggcgta-------------------------acaaac
A0A2K5EPX0_MCL1-01      tgttttcagcgacggcgta-------------------------acaaac
A0A2K5C7L5_MCL1-01      ggccgccgacgccatcatgtcgcccgaagaagagctggacaggtacgagc
A0A2K5CFH3_MCL1-01      ggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagc
A0A2K5CFH3_MCL1-03      ggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagc
                                 *     *                            ** * *

A0A2K5DMS4_MCL1-01      tgg-----------------------------------------------
A0A2K5EPX0_MCL1-02      tgg-----------------------------------------------
A0A2K5EPX0_MCL1-01      tgg-----------------------------------------------
A0A2K5C7L5_MCL1-01      cggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtg
A0A2K5CFH3_MCL1-01      cggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtc
A0A2K5CFH3_MCL1-03      cggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtc
                         **                                               

A0A2K5DMS4_MCL1-01      ---------ggta-----------------ggattgtgactctca-----
A0A2K5EPX0_MCL1-02      ---------ggta-----------------ggatcgtgactctca-----
A0A2K5EPX0_MCL1-01      ---------ggta-----------------ggatcgtgactctca-----
A0A2K5C7L5_MCL1-01      gaggagcctggtaatgactccagtacggatgggtcactaccctcgacgcc
A0A2K5CFH3_MCL1-01      ggggagcctggtaatggctccagtacggacgggtcactaccctcgacgcc
A0A2K5CFH3_MCL1-03      ggggagcctggtaatggctccagtacggacgggtcactaccctcgacgcc
                                 ****                 ** *    ** ***      

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gccgaca---------------------------------tcactggaga
A0A2K5CFH3_MCL1-01      gcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggaga
A0A2K5CFH3_MCL1-03      gcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggaga
                                                                          

A0A2K5DMS4_MCL1-01      -gttcttttggtgcctttgtggccaaacacttg-----aagaccataaa-
A0A2K5EPX0_MCL1-02      -tttcttttggtgcctttgtggccaaacacttg-----aagaccataaa-
A0A2K5EPX0_MCL1-01      -tttcttttggtgcctttgtggccaaacacttg-----aagaccataaa-
A0A2K5C7L5_MCL1-01      ttatctctcggtaccttcgggaacaggcgactggcgccaaggacacaaag
A0A2K5CFH3_MCL1-01      ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaag
A0A2K5CFH3_MCL1-03      ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaag
                           *** * *** **** * *  **  *    *     ***  ** *** 

A0A2K5DMS4_MCL1-01      ccaagaaagttgcatcgaaccattagca-gaaagtatcagatattctc--
A0A2K5EPX0_MCL1-02      ccaagaaagctgcattgaaccattagca-gaaagtattacagacgttctc
A0A2K5EPX0_MCL1-01      ccaagaaagctgcattgaaccattagca-gaaagtattacagacgttctc
A0A2K5C7L5_MCL1-01      ccaatggacaggtccggggccgccagcaggaaggctctggagacctt---
A0A2K5CFH3_MCL1-01      ccaatgggcaggtccggggccgccagcaggaaggcgctggagacctt---
A0A2K5CFH3_MCL1-03      ccaatgggcaggtccggggccgccagcaggaaggcgctggagacctt---
                        ****       *    *  **   **** *** *      * *   *   

A0A2K5DMS4_MCL1-01      ----------------------------------------gctg------
A0A2K5EPX0_MCL1-02      gtaaggacaaaacgggactggc---tagttaaacaaagaggctg------
A0A2K5EPX0_MCL1-01      gtaaggacaaaacgggactggc---tagttaaacaaagaggctg------
A0A2K5C7L5_MCL1-01      ---acgacgggttggggacggcgtgcagcgcaaccacgagacggccttcc
A0A2K5CFH3_MCL1-01      ---acgacgggttggggacggcgtgcagcgcaaccacgagacggccttcc
A0A2K5CFH3_MCL1-03      ---acgacgggttggggacggcgtgcagcgcaaccacgagacggccttcc
                                                                 * *      

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      aa------------------------------------------------
A0A2K5CFH3_MCL1-01      aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatct
A0A2K5CFH3_MCL1-03      aa------------------------------------------------
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactgggg
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      taggattgtgactctcatttcttttggtgcctttgtggccaaacacttga
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      agaccataaaccaagaaagctgcattgaaccattagcagaaagtatcaca
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5DMS4_MCL1-01      ggatgggtttgtggagttcttccgtgtagaggacttagaaggtggcatca
A0A2K5EPX0_MCL1-02      ggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatca
A0A2K5EPX0_MCL1-01      ggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatca
A0A2K5C7L5_MCL1-01      ---------------gttcttccatgtagaagacctagaaggtggcatca
A0A2K5CFH3_MCL1-01      ggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatca
A0A2K5CFH3_MCL1-03      ggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatca
                                       ******** ****** *** ***************

A0A2K5DMS4_MCL1-01      gaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttg
A0A2K5EPX0_MCL1-02      gaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttg
A0A2K5EPX0_MCL1-01      gaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttg
A0A2K5C7L5_MCL1-01      gaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttg
A0A2K5CFH3_MCL1-01      gaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttg
A0A2K5CFH3_MCL1-03      gaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttg
                        ****** ************ *** ***************** *** ****

A0A2K5DMS4_MCL1-01      gcatatctaataagatag--------
A0A2K5EPX0_MCL1-02      gcatatctaataagatag--------
A0A2K5EPX0_MCL1-01      gcatatctaataagatag--------
A0A2K5C7L5_MCL1-01      gcatatctaataagatagccttgtaa
A0A2K5CFH3_MCL1-01      gcactgtctcttataca--catctag
A0A2K5CFH3_MCL1-03      gc------------------------
                        **                        

© 1998-2020Legal notice