Dataset for CDS BAX of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1PAN9_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
Q8HYU5_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
                   ************************************************************

F1PAN9_BAX-01      aagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatgggggga
Q8HYU5_BAX-01      aagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatgggggga
                   ************************************************************

F1PAN9_BAX-01      gagacacctgagctgcccttggagcaggtgccccaggatgcatccaccaagaagctgagc
Q8HYU5_BAX-01      gagacacctgagctgcccttggagcaggtgccccaggatgcatccaccaagaagctgagc
                   ************************************************************

F1PAN9_BAX-01      gaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
Q8HYU5_BAX-01      gaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
                   ************************************************************

F1PAN9_BAX-01      gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttt
Q8HYU5_BAX-01      gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttt
                   ************************************************************

F1PAN9_BAX-01      tctgatggcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactg
Q8HYU5_BAX-01      tctgatggcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactg
                   ************************************************************

F1PAN9_BAX-01      gtgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgggctggaca
Q8HYU5_BAX-01      gtgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgggctggaca
                   ************************************************************

F1PAN9_BAX-01      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgagc
Q8HYU5_BAX-01      ctggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
                   *******************************************************   **

F1PAN9_BAX-01      ctgcagtcc----------------cgaaggagccgaagaccacttgtttgg-----aag
Q8HYU5_BAX-01      ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtg
                   ** *  ***                **  * ** *   *****  * * ***       *

F1PAN9_BAX-01      cctacagggttgt------gttggaggtag---------
Q8HYU5_BAX-01      cttactgcgtcactcaccatctggaaaaagatgggctga
                   * *** * **           ****   **         

© 1998-2020Legal notice