Dataset for CDS BCL2A1 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6TLJ5_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactcaggactatct
A0A2K6TLJ5_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactcaggactatct

A0A2K6TLJ5_BCL2A1-      gcggtatgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
A0A2K6TLJ5_BCL2A1-      gcggtatgtcctgcagataccacaatctggaacgggtccaagcaaaacgt

A0A2K6TLJ5_BCL2A1-      ccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagag
A0A2K6TLJ5_BCL2A1-      ccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagag

A0A2K6TLJ5_BCL2A1-      agtctgaagccatgcttggacaacgttcatattgtgtccatggacaatgc
A0A2K6TLJ5_BCL2A1-      agtctgaagccatgcttggacaacgttcatattgtgtccatggacaatgc

A0A2K6TLJ5_BCL2A1-      cagaacaatattcagtcaagtgatggaaaaggaatttgaagatggcatta
A0A2K6TLJ5_BCL2A1-      cagaacaatattcagtcaagtgatggaaaaggaatttgaagatggcatta

A0A2K6TLJ5_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6TLJ5_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc

A0A2K6TLJ5_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
A0A2K6TLJ5_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga

A0A2K6TLJ5_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
A0A2K6TLJ5_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga

A0A2K6TLJ5_BCL2A1-      taagacgaaacggaggctgggggaaatggaacagtctcatgcttatgcta
A0A2K6TLJ5_BCL2A1-      taagacgaaacggaggctggg-------------------acctat----
                        *********************                    * ***    

A0A2K6TLJ5_BCL2A1-      gtggagtcagcgcagaagaagaagaaaatggctttgtaa
A0A2K6TLJ5_BCL2A1-      ----------cgcaatag---------------------
                                  ****  **                     

© 1998-2020Legal notice