Dataset for CDS BCL-2-like of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

36 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q16548_BCL2A1-03      atgac--------------------------------agactgtgaattt
Q16548_BCL2A1-01      atgac--------------------------------agactgtgaattt
Q16548_BCL2A1-02      atgac--------------------------------agactgtgaattt
C8YZ26_MCL1-01        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
Q07820_MCL1-09        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
B4DU51_MCL1-01        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
B4DLY8_MCL1-01        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        atgtttg------------------gcctcaaaagaaacgcggtaa--tc
P10415_BCL2-04        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-10        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-05        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-08        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-03        atga----------------------------------------------
A9QXG9_BCL2-01        atggcgcacgctgggagaacggggtacgataaccgggagatagtga--tg
P10415_BCL2-06        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-07        atggcgcacgctgggagaacagggtacgataaccgggagatagtga--tg
P10415_BCL2-09        atgg----------------------------------------------
Q07817_BCL2L1-12      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-01      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-03      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-04      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-05      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-06      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-07      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-08      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-09      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-10      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-11      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-02      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-14      atgtctc------------------agagcaaccgggagctggtgg--tt
Q07817_BCL2L1-15      atgtctc------------------agagcaaccgggagctggtgg--tt
                                                                        

Q16548_BCL2A1-03      ggatatat---ttacaggctggctcagga---------------------
Q16548_BCL2A1-01      ggatatat---ttacaggctggctcagga---------------------
Q16548_BCL2A1-02      ggatatat---ttacaggctggctcagga---------------------
C8YZ26_MCL1-01        ggactcaacctctac---------tgtgggggggccggcttg--------
Q07820_MCL1-09        ggactcaacctctac---------tgtgggggggccggcttg--------
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        ggactcaacctctac---------tgtgggggggccggcttg--------
B4DU51_MCL1-01        ggactcaacctctac---------tgtgggggggccggcttg--------
B4DLY8_MCL1-01        ggactcaacctctac---------tgtgggggggccggcttg--------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        ggactcaacctctac---------tgtgggggggccggcttg--------
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ggactcaacctctac---------tgtgggggggccggcttg--------
P10415_BCL2-04        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-10        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-05        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-08        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-06        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-07        aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-01      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-03      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-04      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-05      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-06      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-07      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-08      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-09      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-10      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-11      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-02      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-14      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-15      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
Q07820_MCL1-09        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DU51_MCL1-01        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DLY8_MCL1-01        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
P10415_BCL2-04        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-10        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-05        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-08        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-06        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-07        ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-01      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-03      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-04      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-05      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-06      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-07      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-08      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-09      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-10      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-11      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-02      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-14      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-15      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        c-------------------------------------------------
Q07820_MCL1-09        ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        c-------------------------------------------------
B4DU51_MCL1-01        ctacggag------------------------------------------
B4DLY8_MCL1-01        ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        gccagactcccggagggtcgcgcggccgccgc------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
B4E3L8_MCL1-01        ---------------------atggaagccccggccgctgacgccatcat
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        ---------------------atggaagccccggccgctgacgccatcat
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        ---------------------atggaagccccggccgctgacgccatcat
Q07820_MCL1-03        cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
P10415_BCL2-04        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-10        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-05        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-08        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-06        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-07        -------------------accgggcatcttctcctcccagcccgggca-
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-01      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-03      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-04      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-05      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-06      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-07      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-08      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-09      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-10      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-11      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-02      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-14      -------------------agatggagacccccagtgccatcaatggca-
Q07817_BCL2L1-15      -------------------agatggagacccccagtgccatcaatggca-
                                                                        

Q16548_BCL2A1-03      -------------------------------------ctatctgcagtgc
Q16548_BCL2A1-01      -------------------------------------ctatctgcagtgc
Q16548_BCL2A1-02      -------------------------------------ctatctgcagtgc
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
B4E3L8_MCL1-01        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-03        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
P10415_BCL2-04        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-10        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-05        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-08        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-03        --------------------------------------atcccagggttc
A9QXG9_BCL2-01        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-06        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-07        --------------------cacgccccatccagccgcatcccgggaccc
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-01      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-03      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-04      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-05      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-06      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-07      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-08      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-09      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-10      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-11      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-02      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-14      --------------------acc--------------catcctggcacct
Q07817_BCL2L1-15      --------------------acc--------------catcctggcacct
                                                                        

Q16548_BCL2A1-03      gtcctacag-----------------------------------------
Q16548_BCL2A1-01      gtcctacag-----------------------------------------
Q16548_BCL2A1-02      gtcctacag-----------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
B4E3L8_MCL1-01        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-03        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
P10415_BCL2-04        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-10        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-05        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-08        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-06        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-07        ggtcgccaggacctcgcc-------gct----------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-01      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-03      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-04      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-05      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-06      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-07      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-08      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-09      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-10      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-11      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-02      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-14      ggcagacagccccgcggtgaatggagcc----------------------
Q07817_BCL2L1-15      ggcagacagccccgcggtgaatggagcc----------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
B4E3L8_MCL1-01        accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        accagtacggacgggtcactacccttgacgccgccgccagcagaggagga
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-03        accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
B4E3L8_MCL1-01        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-03        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      ------ataccacaac-------------------------------ctg
Q16548_BCL2A1-01      ------ataccacaac-------------------------------ctg
Q16548_BCL2A1-02      ------ataccacaac-------------------------------ctg
C8YZ26_MCL1-01        ----------caccggcgccaaggacacaaagccaatggg-------cag
Q07820_MCL1-09        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
B4E3L8_MCL1-01        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
Q07820_MCL1-06        ----------caccggcgccaaggacacaaagccaatggg-------cag
B4DU51_MCL1-01        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
B4DLY8_MCL1-01        ------------------ccaaggacacaaagccaatggg-------cag
B4DG83_MCL1-01        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
Q07820_MCL1-03        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
Q07820_MCL1-05        -----------------------------------atggg-------cag
Q07820_MCL1-07        gggagcaggccaccggcgccaaggacacaaagccaatggg-------cag
P10415_BCL2-04        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-10        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-05        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-08        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-06        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-07        ----gcagaccccggctgcccccggcgc--cgccgcggggcctgcgctca
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-01      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-03      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-04      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-05      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-06      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-07      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-08      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-09      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-10      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-11      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-02      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-14      ----actggccacagcagcagtttggat--gcccgggagg-------tga
Q07817_BCL2L1-15      ----actggccacagcagcagtttggat--gcccgggagg-------tga
                                                                        

Q16548_BCL2A1-03      gatcaggtcca-----agcaaaacgtccagagtgctacaaaatgttgcgt
Q16548_BCL2A1-01      gatcaggtcca-----agcaaaacgtccagagtgctacaaaatgttgcgt
Q16548_BCL2A1-02      gatcaggtcca-----agcaaaacgtccagagtgctacaaaatgttgcgt
C8YZ26_MCL1-01        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
Q07820_MCL1-09        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
B4E3L8_MCL1-01        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
Q07820_MCL1-06        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
B4DU51_MCL1-01        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
B4DLY8_MCL1-01        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
B4DG83_MCL1-01        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
Q07820_MCL1-03        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
Q07820_MCL1-05        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
Q07820_MCL1-07        gtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
P10415_BCL2-04        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-10        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-05        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-08        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-06        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-07        gcccggtgccacctgtggtccacc-----tgaccctccgccaggccggcg
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-01      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-03      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-04      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-05      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-06      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-07      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-08      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-09      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-10      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-11      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-02      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-14      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
Q07817_BCL2L1-15      tccccatggca---gcagtaaagc-----aagcgctgagggaggcaggcg
                                                                        

Q16548_BCL2A1-03      tctcagtccaa-aaagaagtggaaaagaatctgaagtcatgcttggacaa
Q16548_BCL2A1-01      tctcagtccaa-aaagaagtggaaaagaatctgaagtcatgcttggacaa
Q16548_BCL2A1-02      tctcagtccaa-aaagaagtggaaaagaatctgaagtcatgcttggacaa
C8YZ26_MCL1-01        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaga
Q07820_MCL1-09        atggcgtgcagcgcaaccacgagacggccttccaa---------------
B4E3L8_MCL1-01        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-06        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DU51_MCL1-01        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DLY8_MCL1-01        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DG83_MCL1-01        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-03        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-05        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-07        atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
P10415_BCL2-04        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-10        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-05        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-08        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-06        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-07        acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-01      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-03      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-04      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-05      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-06      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-07      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-08      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-09      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-10      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-11      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-02      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-14      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-15      acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
                                                                        

Q16548_BCL2A1-03      tgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtga
Q16548_BCL2A1-01      tgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtga
Q16548_BCL2A1-02      tgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtga
C8YZ26_MCL1-01        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
Q07820_MCL1-06        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
B4DU51_MCL1-01        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
B4DLY8_MCL1-01        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
B4DG83_MCL1-01        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
Q07820_MCL1-03        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
Q07820_MCL1-05        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
Q07820_MCL1-07        c-tggacatcaaaaacgaagacg---atgtgaaatcgttgtctcgagtga
P10415_BCL2-04        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-10        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-05        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-08        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-06        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-07        c-tgcacctgacgcccttcaccgc--gcggggacgctttgccacg-gtgg
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-01      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-03      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-04      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-05      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-06      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-07      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-08      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-09      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-10      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-11      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
Q07817_BCL2L1-02      c-tccacatcaccccagggacagc--atatcagagctttga---------
Q07817_BCL2L1-14      c-tccacatcaccccagggacagc--atatcagagctttga---------
Q07817_BCL2L1-15      c-tccacatcaccccagggacagc--atatcagagctttgaacag-gtag
                                                                        

Q16548_BCL2A1-03      tggaaaaggagtttgaagacggcatcattaactggggaagaattgtaacc
Q16548_BCL2A1-01      tggaaaaggagtttgaagacggcatcattaactggggaagaattgtaacc
Q16548_BCL2A1-02      tggaaaaggagtttgaagacggcatcattaactggggaagaattgtaacc
C8YZ26_MCL1-01        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        tgatccatgttttcagcgacagcgtaacaaactggggcaggattgtgact
Q07820_MCL1-06        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
B4DU51_MCL1-01        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
B4DLY8_MCL1-01        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
B4DG83_MCL1-01        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
Q07820_MCL1-03        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
Q07820_MCL1-05        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
Q07820_MCL1-07        tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
P10415_BCL2-04        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-10        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-05        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-08        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-06        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-07        tggaggagctcttcagggacggggt---gaactgggggaggattgtggcc
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-01      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-03      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-04      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-05      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-06      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-07      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-08      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-09      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-10      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-11      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      tgaatgaactcttccgggatggggt---aaactggggtcgcattgtggcc
                                                                        

Q16548_BCL2A1-03      atatttgcatttga--------aggtattctcatcaagaaacttctacga
Q16548_BCL2A1-01      atatttgcatttga--------aggtattctcatcaagaaacttctacga
Q16548_BCL2A1-02      atatttgcatttga--------aggtattctcatcaagaaacttctacga
C8YZ26_MCL1-01        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
Q07820_MCL1-06        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
B4DU51_MCL1-01        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
B4DLY8_MCL1-01        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
B4DG83_MCL1-01        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
Q07820_MCL1-03        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
Q07820_MCL1-05        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
Q07820_MCL1-07        ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
P10415_BCL2-04        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-10        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-05        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-08        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-06        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-07        ttctttgagttcgg------tggggtcatgtgtgtggagagcgtcaaccg
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-01      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-03      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-04      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-05      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-06      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-07      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-08      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-09      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-10      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-11      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      tttttctccttcgg------cggggcactgtgcgtggaaagcgtagacaa
                                                                        

Q16548_BCL2A1-03      cagcaaattgccccggatgtggatacctataaggagatttcatattttgt
Q16548_BCL2A1-01      cagcaaattgccccggatgtggatacctataaggagatttcatattttgt
Q16548_BCL2A1-02      cagcaaattgccccggatgtggatacctataaggagatttcatattttgt
C8YZ26_MCL1-01        agaaa--------------------------gctgcatcgaaccattagc
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        agaaa--------------------------gctgcatcgaaccattagc
Q07820_MCL1-06        agaaa--------------------------gctgcatcgaaccattagc
B4DU51_MCL1-01        agaaa--------------------------gctgcatcgaaccattagc
B4DLY8_MCL1-01        agaaa--------------------------gctgcatcgaaccattagc
B4DG83_MCL1-01        agaaa--------------------------gctgcatcgaaccattagc
Q07820_MCL1-03        agaaa--------------------------gctgcatcgaaccattagc
Q07820_MCL1-05        agaaa--------------------------gctgcatcgaaccattagc
Q07820_MCL1-07        agaaa--------------------------gctgcatcgaaccattagc
P10415_BCL2-04        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-10        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-05        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-08        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-06        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-07        ggagatgtcgcccctggtg-----------gacaacatcgccctgtggat
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-01      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-03      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-04      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-05      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-06      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-07      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-08      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-09      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-10      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-11      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      ggagatgcaggtattggtg-----------agtcggatcgcagcttggat
                                                                        

Q16548_BCL2A1-03      tgcggagttcataa---------tgaataacacaggagaatggataaggc
Q16548_BCL2A1-01      tgcggagttcataa---------tgaataacacaggagaatggataaggc
Q16548_BCL2A1-02      tgcggagttcataa---------tgaataacacaggagaatggataaggc
C8YZ26_MCL1-01        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
Q07820_MCL1-06        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
B4DU51_MCL1-01        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
B4DLY8_MCL1-01        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
B4DG83_MCL1-01        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
Q07820_MCL1-03        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
Q07820_MCL1-05        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
Q07820_MCL1-07        agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagtta
P10415_BCL2-04        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-10        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-05        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-08        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-06        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-07        gactgagtacctgaaccggcacctgcacac---------ctggatccagg
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-01      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-03      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-04      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-05      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-06      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-07      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-08      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-09      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-10      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-11      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      ggccacttacctgaatgaccacctagagcc---------ttggatccagg
                                                                        

Q16548_BCL2A1-03      aaaacggaggct--------------------------------------
Q16548_BCL2A1-01      aaaacggaggctg-------------------------------------
Q16548_BCL2A1-02      aaaacggaggct--------------------------------------
C8YZ26_MCL1-01        aacaaagaggctg-------------------------------------
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        aacaaagaggctg-------------------------------------
Q07820_MCL1-06        aacaaagaggctg-------------------------------------
B4DU51_MCL1-01        aacaaagaggctg-------------------------------------
B4DLY8_MCL1-01        aacaaagaggctg-------------------------------------
B4DG83_MCL1-01        aacaaagaggctg-------------------------------------
Q07820_MCL1-03        aacaaagaggctg-------------------------------------
Q07820_MCL1-05        aacaaagaggctg-------------------------------------
Q07820_MCL1-07        aacaaagaggctg-------------------------------------
P10415_BCL2-04        ataacggaggctg-------------------------------------
P10415_BCL2-10        ataacggaggctg-------------------------------------
P10415_BCL2-05        ataacggaggctg-------------------------------------
P10415_BCL2-08        ataacggaggctg-------------------------------------
P10415_BCL2-03        ------caggcca-------------------------------------
A9QXG9_BCL2-01        ataacggaggctg-------------------------------------
P10415_BCL2-06        ataacggaggctg-------------------------------------
P10415_BCL2-07        ataacggaggctg-------------------------------------
P10415_BCL2-09        ------------a-------------------------------------
Q07817_BCL2L1-12      agaacggcggctg-------------------------------------
Q07817_BCL2L1-01      agaacggcggctg-------------------------------------
Q07817_BCL2L1-03      agaacggcggctg-------------------------------------
Q07817_BCL2L1-04      agaacggcggctg-------------------------------------
Q07817_BCL2L1-05      agaacggcggctg-------------------------------------
Q07817_BCL2L1-06      agaacggcggctg-------------------------------------
Q07817_BCL2L1-07      agaacggcggctg-------------------------------------
Q07817_BCL2L1-08      agaacggcggctg-------------------------------------
Q07817_BCL2L1-09      agaacggcggctg-------------------------------------
Q07817_BCL2L1-10      agaacggcggctg-------------------------------------
Q07817_BCL2L1-11      agaacggcggctg-------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      agaacggcggctggctggattggtggtgcttctgctcagctcaccttaga
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        --------------------------------------------------
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        --------------------------------------------------
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      gtaatcatcactgacggaggagactggggaggtcccatccttcccctggg
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        --------------------------------------------------
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        --------------------------------------------------
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      ctcagctgggtccccagacctacacctgaaccccacgcctgtctggtgtt
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        --------------------------------------------------
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        --------------------------------------------------
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        --------------------------------------------------
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      tacggattgaagctgccaccctttgggacctatcctgttttcatttctgc
                                                                        

Q16548_BCL2A1-03      -----------------------------------gg-------------
Q16548_BCL2A1-01      -----------------------------------gg-------------
Q16548_BCL2A1-02      -----------------------------------gg-------------
C8YZ26_MCL1-01        -----------------------------------ggatgggtttgtgga
Q07820_MCL1-09        -----------------------------------ggatgggtttgtgga
B4E3L8_MCL1-01        -----------------------------------ggatgggtttgtgga
Q07820_MCL1-06        -----------------------------------ggatgggtttgtgga
B4DU51_MCL1-01        -----------------------------------ggatgggtttgtgga
B4DLY8_MCL1-01        -----------------------------------ggatgggtttgtgga
B4DG83_MCL1-01        -----------------------------------ggatgggtttgtgga
Q07820_MCL1-03        -----------------------------------ggatgggtttgtgga
Q07820_MCL1-05        -----------------------------------ggatgggtttgtgga
Q07820_MCL1-07        -----------------------------------ggatgggtttgtgga
P10415_BCL2-04        -----------------------------------g--------------
P10415_BCL2-10        -----------------------------------g--------------
P10415_BCL2-05        -----------------------------------g--------------
P10415_BCL2-08        -----------------------------------gacagaaactcagga
P10415_BCL2-03        -----------------------------------ggatgcctttgtgga
A9QXG9_BCL2-01        -----------------------------------ggatgcctttgtgga
P10415_BCL2-06        -----------------------------------ggatgcctttgtgga
P10415_BCL2-07        -----------------------------------ggatgcctttgtgga
P10415_BCL2-09        -----------------------------------ggatgcctttgtgga
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-03      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-04      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-05      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-06      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-07      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-08      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-09      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-10      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-11      -----------------------------------ggatacttttgtgga
Q07817_BCL2L1-02      --------------------------------acaggatacttttgtgga
Q07817_BCL2L1-14      --------------------------------acaggatacttttgtgga
Q07817_BCL2L1-15      tctcagctctctggtctctgtggacctcacttacaggatacttttgtgga
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        gttcttccaagtagaggaccta----------------------------
Q07820_MCL1-09        gttcttccatgtagaggaccta----------------------------
B4E3L8_MCL1-01        gttcttccatgtagaggaccta----------------------------
Q07820_MCL1-06        gttcttccatgtagaggaccta----------------------------
B4DU51_MCL1-01        gttcttccatgtagaggaccta----------------------------
B4DLY8_MCL1-01        gttcttccatgtagaggaccta----------------------------
B4DG83_MCL1-01        gttcttccatgtagaggaccta----------------------------
Q07820_MCL1-03        gttcttccatgtagaggaccta----------------------------
Q07820_MCL1-05        gttcttccatgtagaggaccta----------------------------
Q07820_MCL1-07        gttcttccatgtagaggaccta----------------------------
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        tctgttc--------aacagtaatgcctgttcccccacgcctgcagcctt
P10415_BCL2-03        actgtac--------ggcccca----------------------------
A9QXG9_BCL2-01        actgtac--------ggcccca----------------------------
P10415_BCL2-06        actgtac--------ggcccca----------------------------
P10415_BCL2-07        actgtac--------ggcccca----------------------------
P10415_BCL2-09        actgtac--------ggcccca----------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-03      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-04      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-05      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-06      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-07      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-08      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-09      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-10      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-11      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-02      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-14      actctat--------gggaacaatgcagcagccgagagcc----------
Q07817_BCL2L1-15      actctat--------gggaacaatgcagcagccgagagcc----------
                                                                        

Q16548_BCL2A1-03      --------------------------------------------------
Q16548_BCL2A1-01      --------------------------------------------------
Q16548_BCL2A1-02      --------------------------------------------------
C8YZ26_MCL1-01        --------------------------------------------------
Q07820_MCL1-09        --------------------------------------------------
B4E3L8_MCL1-01        --------------------------------------------------
Q07820_MCL1-06        --------------------------------------------------
B4DU51_MCL1-01        --------------------------------------------------
B4DLY8_MCL1-01        --------------------------------------------------
B4DG83_MCL1-01        --------------------------------------------------
Q07820_MCL1-03        --------------------------------------------------
Q07820_MCL1-05        --------------------------------------------------
Q07820_MCL1-07        --------------------------------------------------
P10415_BCL2-04        --------------------------------------------------
P10415_BCL2-10        --------------------------------------------------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        ggcaaccaccatactactgcctgcctctatgaacttgactactctaggta
P10415_BCL2-03        --------------------------------------------------
A9QXG9_BCL2-01        --------------------------------------------------
P10415_BCL2-06        --------------------------------------------------
P10415_BCL2-07        --------------------------------------------------
P10415_BCL2-09        --------------------------------------------------
Q07817_BCL2L1-12      --------------------------------------------------
Q07817_BCL2L1-01      --------------------------------------------------
Q07817_BCL2L1-03      --------------------------------------------------
Q07817_BCL2L1-04      --------------------------------------------------
Q07817_BCL2L1-05      --------------------------------------------------
Q07817_BCL2L1-06      --------------------------------------------------
Q07817_BCL2L1-07      --------------------------------------------------
Q07817_BCL2L1-08      --------------------------------------------------
Q07817_BCL2L1-09      --------------------------------------------------
Q07817_BCL2L1-10      --------------------------------------------------
Q07817_BCL2L1-11      --------------------------------------------------
Q07817_BCL2L1-02      --------------------------------------------------
Q07817_BCL2L1-14      --------------------------------------------------
Q07817_BCL2L1-15      --------------------------------------------------
                                                                        

Q16548_BCL2A1-03      ------gtatgtgtgatggaaaaattc-----------------ttcatt
Q16548_BCL2A1-01      ------ggaaatggc-------acaat-----------------cacaca
Q16548_BCL2A1-02      ------gaaaatggctttgtaaagaag-----------------tttgaa
C8YZ26_MCL1-01        ------gaaggtggcatcaggaatgtg-----------------ctgctg
Q07820_MCL1-09        ------gaaggtggcatcaggaatgtg-----------------ctgctg
B4E3L8_MCL1-01        ------gaaggtggcatcaggaatgtg-----------------ctgctg
Q07820_MCL1-06        ------gaaggtggcatcaggaatgtg-----------------ctgctg
B4DU51_MCL1-01        ------gaaggtggcatcaggaatgtg-----------------ctgctg
B4DLY8_MCL1-01        ------gaaggtggcatcaggaatgtg-----------------ctgctg
B4DG83_MCL1-01        ------gaaggtggcatcaggaatgtg-----------------ctgctg
Q07820_MCL1-03        ------gaaggtggcatcaggaatgtg-----------------ctgctg
Q07820_MCL1-05        ------gaaggtggcatcaggaatgtg-----------------ctgctg
Q07820_MCL1-07        ------gaaggtggcatcaggaatgtg-----------------ctgctg
P10415_BCL2-04        ------gtaggtgcacttggtgatgtga----------------------
P10415_BCL2-10        ------gtaggtgcacttggtgatgtga----------------------
P10415_BCL2-05        ctttacat------------------------------------------
P10415_BCL2-08        cctcgcataagtggactcacacttgtgactggcttgttacactaagcatg
P10415_BCL2-03        ------gcatgcggcctctg---tttgatttctcctggctgtctctgaag
A9QXG9_BCL2-01        ------gcatgcggcctctg---tttgatttctcctggctgtctctgaag
P10415_BCL2-06        ------gcatgcggcctctg---tttgatttctcctggctgtctctgaag
P10415_BCL2-07        ------gcatgcggcctctg---tttgatttctcctggctgtctctgaag
P10415_BCL2-09        ------gcatgcggcctctg---tttgatttctcctggctgtctctgaag
Q07817_BCL2L1-12      ---------ggtgccaga-----------tgccagttttaga--------
Q07817_BCL2L1-01      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-03      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-04      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-05      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-06      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-07      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-08      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-09      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-10      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-11      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-02      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-14      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
Q07817_BCL2L1-15      ------gaaagggccaggaacgcttcaaccgctggttcctgacgggcatg
                                                                        

Q16548_BCL2A1-03      gttctttcctgtgaaat------------agaaattgagaatttccttgc
Q16548_BCL2A1-01      cctatg-ctggtagagtcagtggcccacaagaagaggaaaatggctttgt
Q16548_BCL2A1-02      cctaaatctggctggatgacttttctagaagttacaggaaagatctgtga
C8YZ26_MCL1-01        gcttttgcaggtgttgc------------tggagtaggag----------
Q07820_MCL1-09        gcttttgcaggtgttgc------------tggagtaggag----------
B4E3L8_MCL1-01        gcttttgcaggtgttgc------------tggagtaggag----------
Q07820_MCL1-06        gcttttgcaggtgttgc------------tggagtaggag----------
B4DU51_MCL1-01        gcttttgcaggtgttgc------------tggagtaggag----------
B4DLY8_MCL1-01        gcttttgcaggtgttgc------------tggagtaggag----------
B4DG83_MCL1-01        gcttttgcaggtgttgc------------tggagtaggag----------
Q07820_MCL1-03        gcttttgcaggtgttgc------------tggagtaggag----------
Q07820_MCL1-05        gcttttgcaggtgttgc------------tggagtaggag----------
Q07820_MCL1-07        gcttttgcaggtgttgc------------tggagtaggag----------
P10415_BCL2-04        ---------------------------------gtctgggc---------
P10415_BCL2-10        ---------------------------------gtctgggc---------
P10415_BCL2-05        --------------------------------------------------
P10415_BCL2-08        atgtcttcaaggttcat------------ccatgttttggcctgtgtcac
P10415_BCL2-03        actctgctcagtttggc------------cctggtgggagcttgcatcac
A9QXG9_BCL2-01        actctgctcagtttggc------------cctggtgggagcttgcatcac
P10415_BCL2-06        actctgctcagtttggc------------cctggtgggagcttgcatcac
P10415_BCL2-07        actctgctcagtttggc------------cctggtgggagcttgcatcac
P10415_BCL2-09        actctgctcagtttggc------------cctggtgggagcttgcatcac
Q07817_BCL2L1-12      -------------------------------tt-----------------
Q07817_BCL2L1-01      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-03      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-04      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-05      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-06      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-07      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-08      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-09      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-10      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-11      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-02      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-14      actgtggccggcgtggt------------tctg-----------------
Q07817_BCL2L1-15      actgtggccggcgtggt------------tctg-----------------
                                                                        

Q16548_BCL2A1-03      ta------------------------g-------ttaa
Q16548_BCL2A1-01      aa------------------------------------
Q16548_BCL2A1-02      aatgctatctctcctgaagcaatactg-------ttga
C8YZ26_MCL1-01        -ctggtttggcatatctaaaaagatag-----------
Q07820_MCL1-09        -ctggtttggcatatctaataagatagccttactgtaa
B4E3L8_MCL1-01        -ctggtttggcatatctaataagatag-----------
Q07820_MCL1-06        -ctggtttggcatatctaataagatag-----------
B4DU51_MCL1-01        -ctggtttggcatatctaataagatag-----------
B4DLY8_MCL1-01        -ctggtttggcatatctaataagatag-----------
B4DG83_MCL1-01        -ctggtttggcatatctaataagatag-----------
Q07820_MCL1-03        -ctggtttggcatatctaataagatag-----------
Q07820_MCL1-05        -ctggtttggcatatctaataagatag-----------
Q07820_MCL1-07        -ctggtttggcatatctaataagatag-----------
P10415_BCL2-04        -------------------------tg----------a
P10415_BCL2-10        -------------------------tg----------a
P10415_BCL2-05        ------------------------gtg----------a
P10415_BCL2-08        agcttccttcattttgaaggctgaatg----------a
P10415_BCL2-03        cctgggtgcctatctgggccacaagtg----------a
A9QXG9_BCL2-01        cctgggtgcctatctgagccacaagtg----------a
P10415_BCL2-06        cctgggtgcctatctgggccacaagtg----------a
P10415_BCL2-07        cctgggtgcctatctgggccacaagtg----------a
P10415_BCL2-09        cctgggtgcctatctgggccacaagtg----------a
Q07817_BCL2L1-12      -ctggctccacc-----------actg----------a
Q07817_BCL2L1-01      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-03      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-04      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-05      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-06      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-07      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-08      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-09      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-10      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-11      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-02      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-14      -ctgggctcactcttcagtcggaaatg----------a
Q07817_BCL2L1-15      -ctgggctcactcttcagtcggaaatg----------a
                                                            

© 1998-2022Legal notice