Dataset for CDS BCL-2-like of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B4E1X9_BCL2A1-01       atgacagac-------------------tgtgaatttggatatatttaca
Q16548_BCL2A1-01       atgacagac-------------------tgtgaatttggatatatttaca
C8YZ26_MCL1-01         atgtttggc------ctcaaaagaaacgcggtaatc-------------g
B4DLY8_MCL1-01         atgtttggc------ctcaaaagaaacgcggtaatc-------------g
B4E3L8_MCL1-01         atg-----------------------------------------------
B4DG83_MCL1-01         atg-----------------------------------------------
B4DU51_MCL1-01         atgtttggc------ctcaaaagaaacgcggtaatc-------------g
Q07820_MCL1-04         atgtttggc------ctcaaaagaaacgcggtaatc-------------g
A9QXG9_BCL2-01         atggcgcac--gctgggagaacggggtacgataaccgggagatagtgatg
Q9HD36_BCL2L10-02      atggttgaccagttgcgggagcgcaccaccatggcc--gacccgctgcgg
                       ***                                               

B4E1X9_BCL2A1-01       ggctggctc-------------------aggactat--ctgcagtgc--g
Q16548_BCL2A1-01       ggctggctc-------------------aggactat--ctgcagtgc--g
C8YZ26_MCL1-01         gactcaacc--------tctactgtgggggggccgg--cttgggggccgg
B4DLY8_MCL1-01         gactcaacc--------tctactgtgggggggccgg--cttgggggccgg
B4E3L8_MCL1-01         --------------------------------------------------
B4DG83_MCL1-01         --------------------------------------------------
B4DU51_MCL1-01         gactcaacc--------tctactgtgggggggccgg--cttgggggccgg
Q07820_MCL1-04         gactcaacc--------tctactgtgggggggccgg--cttgggggccgg
A9QXG9_BCL2-01         aagtacatccattataagctgtcgcagaggggctacgagtgggatgcggg
Q9HD36_BCL2L10-02      gagcgcacc------gagctgttgctggccgactac--ctggggtactgc
                                                                         

B4E1X9_BCL2A1-01       tcctacagataccacaacctggatc-------------------------
Q16548_BCL2A1-01       tcctacagataccacaacctggatc-------------------------
C8YZ26_MCL1-01         cagcggcggcgccacccgcccgggagggcgactttt--------------
B4DLY8_MCL1-01         cagcggcggcgccacccgcccgggagggcgacttttggctacggagaagg
B4E3L8_MCL1-01         -------------------------------------------------g
B4DG83_MCL1-01         -------------------------------------------------g
B4DU51_MCL1-01         cagcggcggcgccacccgcccgggagggcgacttttggctacggagatgg
Q07820_MCL1-04         cagcggcggcgccacccgcccgggagggcgactttt--------------
A9QXG9_BCL2-01         agatgtgggcgccgcgcccccg----ggggccgcccccgcaccgggcatc
Q9HD36_BCL2L10-02      gcccgggaacccggcacccccgagccggcgccatccacgcccgaggccg-
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         aggcctcg--------------------gcccggcgagagatagggggag
B4E3L8_MCL1-01         aagccccggccgctgacgccatcatgtcgcccgaagaggagctggacggg
B4DG83_MCL1-01         aagccccggccgctgacgccatcatgtcgcccgaagaggagctggacggg
B4DU51_MCL1-01         aagccccggccgctgacgccatcatgtcgcccgaagaggagctggacggg
Q07820_MCL1-04         --------------------------------------------------
A9QXG9_BCL2-01         ttctcctcccagcccgggcacacgccccatcca-----------------
Q9HD36_BCL2L10-02      -------------ccgtgc-tgcgctccg--cg-----------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         gggaggccggcgc-------------------------------------
B4E3L8_MCL1-01         tacgagccggagcctctcgggaagcggccggctgtcctgccgctgctgga
B4DG83_MCL1-01         tacgagccggagcctctcgggaagcggccggctgtcctgccgctgctgga
B4DU51_MCL1-01         tacgagccggagcctctcgggaagcggccggctgtcctgccgctgctgga
Q07820_MCL1-04         --------------------------------------------------
A9QXG9_BCL2-01         -----gccgcatccc-----------------------------------
Q9HD36_BCL2L10-02      -----gccg----cc-----------------------------------
                                                                         

B4E1X9_BCL2A1-01       ---------aggtccaagcaaaacgtccagag------------------
Q16548_BCL2A1-01       ---------aggtccaagcaaaacgtccagag------------------
C8YZ26_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         ---------ggtgattggcggaagcgccggcgcaagc------cccccgt
B4E3L8_MCL1-01         gttggtcggggaatctggtaataacaccagtacggacgggtcactaccct
B4DG83_MCL1-01         gttggtcggggaatctggtaataacaccagtacggacgggtcactaccct
B4DU51_MCL1-01         gttggtcggggaatctggtaataacaccagtacggacgggtcactaccct
Q07820_MCL1-04         --------------------------------------------------
A9QXG9_BCL2-01         ---------gggacccgg-----tcgccaggac------------ctcgc
Q9HD36_BCL2L10-02      ---------aggttacggcagattcaccggtcc------------ttttt
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         ccaccctcacgccaga----------------------------------
B4E3L8_MCL1-01         cgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcg
B4DG83_MCL1-01         cgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcg
B4DU51_MCL1-01         tgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcg
Q07820_MCL1-04         --------------------------------------------------
A9QXG9_BCL2-01         cgctgcagaccccggc----------------------------------
Q9HD36_BCL2L10-02      ctccgcctacctcggc----------------------------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------tgctacaaaatgttgcgt
Q16548_BCL2A1-01       --------------------------------tgctacaaaatgttgcgt
C8YZ26_MCL1-01         --------------------------------ggccaccg------gcg-
B4DLY8_MCL1-01         -----------ctcccgg-------agggtcgcgcggccg------ccgc
B4E3L8_MCL1-01         ctggagattatctctcggtaccttcgggagcaggccaccg------gcg-
B4DG83_MCL1-01         ctggagattatctctcggtaccttcgggagcaggccaccg------gcg-
B4DU51_MCL1-01         ctggagattatctctcggtaccttcgggagcaggccaccg------gcg-
Q07820_MCL1-04         --------------------------------ggccaccg------gcg-
A9QXG9_BCL2-01         --------------------------------tgcccccg------gcg-
Q9HD36_BCL2L10-02      --------------------------------taccccgg------gaa-
                                                         *  *            

B4E1X9_BCL2A1-01       tctcagtccaaaaagaagtggaaaagaatctgaagtcat-----------
Q16548_BCL2A1-01       tctcagtccaaaaagaagtggaaaagaatctgaagtcat-----------
C8YZ26_MCL1-01         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
B4DLY8_MCL1-01         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
B4E3L8_MCL1-01         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
B4DG83_MCL1-01         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
B4DU51_MCL1-01         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
Q07820_MCL1-04         ccaaggacacaaagccaatgggcagg--tctggggccaccagcaggaagg
A9QXG9_BCL2-01         cc---gccgcggggcctgcgctca-g--cccggtgccacctgtggtcca-
Q9HD36_BCL2L10-02      cc---gcttcgag----------------ctggtggcgctgatggcggat
                        *   *                       * *  * *             

B4E1X9_BCL2A1-01       -gcttg-------------------------------------------g
Q16548_BCL2A1-01       -gcttg-------------------------------------------g
C8YZ26_MCL1-01         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
B4DLY8_MCL1-01         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
B4E3L8_MCL1-01         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
B4DG83_MCL1-01         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
B4DU51_MCL1-01         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
Q07820_MCL1-04         cgctggagaccttacgacgggttggggatggc--------gtgcagcgca
A9QXG9_BCL2-01         -cctga---ccctccgccaggccggcgacgacttctcccgccgc------
Q9HD36_BCL2L10-02      tccgtg---ctctccgacagccc-----cggccccacctggggcagagtg
                         *                                               

B4E1X9_BCL2A1-01       acaatgttaatgttgtgtccgtagacactgccagaacacta---------
Q16548_BCL2A1-01       acaatgttaatgttgtgtccgtagacactgccagaacacta---------
C8YZ26_MCL1-01         accacga-gacggccttccaaggcatgc--ttcggagactg-----gaca
B4DLY8_MCL1-01         accacga-gacggccttccaaggcatgc--ttcggaaactg-----gaca
B4E3L8_MCL1-01         accacga-gacggccttccaaggcatgc--ttcggaaactg-----gaca
B4DG83_MCL1-01         accacga-gacggccttccaaggcatgc--ttcggaaactg-----gaca
B4DU51_MCL1-01         accacga-gacggccttccaaggcatgc--ttcggaaactg-----gaca
Q07820_MCL1-04         accacga-gacggccttccaaggcatgc--ttcggaaactg-----gaca
A9QXG9_BCL2-01         -taccgc-cgcga-cttcgccgagatgt--ccagccagctgcacctgacg
Q9HD36_BCL2L10-02      gtgacgctcgtgaccttcgcagggacgctgctggagagagg-----gccg
                            *     *   *        *        *                

B4E1X9_BCL2A1-01       --------------------------------ttcaaccaagtgatggaa
Q16548_BCL2A1-01       --------------------------------ttcaaccaagtgatggaa
C8YZ26_MCL1-01         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
B4DLY8_MCL1-01         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
B4E3L8_MCL1-01         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
B4DG83_MCL1-01         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
B4DU51_MCL1-01         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
Q07820_MCL1-04         tcaaaaac------gaagacgatgtgaaatcgttgtctcgagtgatgatc
A9QXG9_BCL2-01         cccttcaccgcgcg-----------gggacgctttgccacggtggtggag
Q9HD36_BCL2L10-02      ctggtgaccgcccggtggaagaagtggggcttccagccgcggc--taaag
                                                                *   *    

B4E1X9_BCL2A1-01       aaggagtttgaagacggcatcattaactggggaagaattgtaaccatatt
Q16548_BCL2A1-01       aaggagtttgaagacggcatcattaactggggaagaattgtaaccatatt
C8YZ26_MCL1-01         catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
B4DLY8_MCL1-01         catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
B4E3L8_MCL1-01         catgttttcagcgacagcgtaacaaactggggcaggattgtgactctcat
B4DG83_MCL1-01         catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
B4DU51_MCL1-01         catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
Q07820_MCL1-04         catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
A9QXG9_BCL2-01         gagctcttcagggacggggt---gaactgggggaggattgtggccttctt
Q9HD36_BCL2L10-02      gagcaggagggcgacgtcgcccgggactgccagcgcctggtggcctt-gc
                        *          ***          ****     *  * **  *  *   

B4E1X9_BCL2A1-01       tgcatttgaaggtattct-------catcaagaaacttctacgacagcaa
Q16548_BCL2A1-01       tgcatttgaaggtattct-------catcaagaaacttctacgacagcaa
C8YZ26_MCL1-01         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DLY8_MCL1-01         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4E3L8_MCL1-01         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DG83_MCL1-01         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
B4DU51_MCL1-01         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
Q07820_MCL1-04         ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A9QXG9_BCL2-01         tgagttcggtggggtcatgtgtg------tggagagcgtcaaccgggag-
Q9HD36_BCL2L10-02      tgagctcg--cggctcatg-------------------------gggca-
                       *    * *      *  *                            *   

B4E1X9_BCL2A1-01       attgccccggatgtggatacc--tataaggagatttcatattttg--ttg
Q16548_BCL2A1-01       attgccccggatgtggatacc--tataaggagatttcatattttg--ttg
C8YZ26_MCL1-01         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
B4DLY8_MCL1-01         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
B4E3L8_MCL1-01         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
B4DG83_MCL1-01         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
B4DU51_MCL1-01         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
Q07820_MCL1-04         gctgcatcg--------aaccattagcagaaagtatca-----cagac--
A9QXG9_BCL2-01         ---atgtcg--------cccc--tggtggacaacatcgccctgtggatga
Q9HD36_BCL2L10-02      ---gcaccg--------cgcc--tggctgcaggctcag---ggcggctgg
                              **          **  *    *                     

B4E1X9_BCL2A1-01       cggagttcataatgaataacacaggagaat--ggataaggcaaaacggag
Q16548_BCL2A1-01       cggagttcataatgaataacacaggagaat--ggataaggcaaaacggag
C8YZ26_MCL1-01         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
B4DLY8_MCL1-01         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
B4E3L8_MCL1-01         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
B4DG83_MCL1-01         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
B4DU51_MCL1-01         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
Q07820_MCL1-04         ----gttctcgt--aaggacaaaacgggactggctagttaaacaa-agag
A9QXG9_BCL2-01         ctgagtacctga--accggcacctgcacacctggatccaggataacggag
Q9HD36_BCL2L10-02      gtgagcacgcg---gcggacaccgggacacgggg---cgggacg--ggca
                           *  *           **       *   *        *     *  

B4E1X9_BCL2A1-01       gctgggtatgtg---tgatgga---------------aaaatt-------
Q16548_BCL2A1-01       gctgggaaaatggctttgtaaa---------------gaagtttgaacct
C8YZ26_MCL1-01         gctggg---atgggtttgtggagttcttccaagtagaggacctagaaggt
B4DLY8_MCL1-01         gctggg---atgggtttgtggagttcttccatgtagaggacctagaaggt
B4E3L8_MCL1-01         gctggg---atgggtttgtggagttcttccatgtagaggacctagaaggt
B4DG83_MCL1-01         gctggg---atgggtttgtggagttcttccatgtagaggacctagaaggt
B4DU51_MCL1-01         gctggg---atgggtttgtggagttcttccatgtagaggacctagaaggt
Q07820_MCL1-04         gctggg---atgggtttgtggagttcttccatgtagaggacctagaaggt
A9QXG9_BCL2-01         gctggg---atgcctttgtggaact-gtac-------ggccccagcatgc
Q9HD36_BCL2L10-02      gccggg---aagcgcccacgaggctggcac-------ggatggcttttgt
                       ** ***     *                                      

B4E1X9_BCL2A1-01       --------cttca------------ttgttctttcctgtga---------
Q16548_BCL2A1-01       aaatctggctgga------------tgacttttctagaagt---------
C8YZ26_MCL1-01         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
B4DLY8_MCL1-01         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
B4E3L8_MCL1-01         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
B4DG83_MCL1-01         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
B4DU51_MCL1-01         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
Q07820_MCL1-04         ggcatc---agga---atgtgctgctggc---ttttgcagg---------
A9QXG9_BCL2-01         ggcctctgtttga-----tttctcctggctgtctctgaaga---------
Q9HD36_BCL2L10-02      cacttcttcaggaccccctttccactggc--tttttggagaaaacagctg
                                   *            *             *          

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
C8YZ26_MCL1-01         ------------------------------------------tgttgctg
B4DLY8_MCL1-01         ------------------------------------------tgttgctg
B4E3L8_MCL1-01         ------------------------------------------tgttgctg
B4DG83_MCL1-01         ------------------------------------------tgttgctg
B4DU51_MCL1-01         ------------------------------------------tgttgctg
Q07820_MCL1-04         ------------------------------------------tgttgctg
A9QXG9_BCL2-01         ----------ctctg--------------------ctcagtttggccctg
Q9HD36_BCL2L10-02      gtccaggcttttctgtcatgcttgttaacaacagccttcatttatctctg
                                                                         

B4E1X9_BCL2A1-01       ---------aatagaaa----ttgagaa--------tttcct-------t
Q16548_BCL2A1-01       ---------tacaggaaagatctgtgaaatgctatctctcctgaagcaat
C8YZ26_MCL1-01         g--------agtaggag----ctggtt-----------------tggcat
B4DLY8_MCL1-01         g--------agtaggag----ctggtt-----------------tggcat
B4E3L8_MCL1-01         g--------agtaggag----ctggtt-----------------tggcat
B4DG83_MCL1-01         g--------agtaggag----ctggtt-----------------tggcat
B4DU51_MCL1-01         g--------agtaggag----ctggtt-----------------tggcat
Q07820_MCL1-04         g--------agtaggag----ctggtt-----------------tggcat
A9QXG9_BCL2-01         g----------tgggag----cttgca--------tcaccctgggtgcct
Q9HD36_BCL2L10-02      gacacgattattatgag----ttttaaa--acttttaaccc---gcttct
                                      *      *                          *

B4E1X9_BCL2A1-01       gctagt--------taa
Q16548_BCL2A1-01       act-gt--------tga
C8YZ26_MCL1-01         atctaa---aaagatag
B4DLY8_MCL1-01         atctaa---taagatag
B4E3L8_MCL1-01         atctaa---taagatag
B4DG83_MCL1-01         atctaa---taagatag
B4DU51_MCL1-01         atctaa---taagatag
Q07820_MCL1-04         atctaa---taagatag
A9QXG9_BCL2-01         atctgagccacaagtga
Q9HD36_BCL2L10-02      acctgc-ccaactgtga
                                     *  

© 1998-2020Legal notice