Dataset for CDS BCL-2-like of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

51 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q16548_BCL2A1-03        atgac--------------------------------agactgtgaattt
Q16548_BCL2A1-01        atgac--------------------------------agactgtgaattt
Q16548_BCL2A1-02        atgac--------------------------------agactgtgaattt
Q9HD36_BCL2L10-01       atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcggga
Q9HD36_BCL2L10-02       atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcggga
C8YZ26_MCL1-01          atgtttg--------------------gcctcaaaagaaacgcggtaatc
Q07820_MCL1-09          atgtttg--------------------gcctcaaaagaaacgcggtaatc
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          atgtttg--------------------gcctcaaaagaaacgcggtaatc
B4DU51_MCL1-01          atgtttg--------------------gcctcaaaagaaacgcggtaatc
B4DLY8_MCL1-01          atgtttg--------------------gcctcaaaagaaacgcggtaatc
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          atgtttg--------------------gcctcaaaagaaacgcggtaatc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          atgtttg--------------------gcctcaaaagaaacgcggtaatc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      atggcga-----ccccagcctcggccccagacacacgggctctggtggca
A0A7I2V383_BCL2L2-      atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-08        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-07        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-06        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-05        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-04        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-03        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-02        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
A0A7I2V383_BCL2L2-      atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-01        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
Q92843_BCL2L2-09        atggcga-----ccccagcctcggccccagacacacgggctctggtggca
P10415_BCL2-04          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-10          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-05          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-08          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-03          atga----------------------------------------------
A9QXG9_BCL2-01          atggcgcac--gctgggagaacggggtacgataaccgggagatagtgatg
P10415_BCL2-06          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-07          atggcgcac--gctgggagaacagggtacgataaccgggagatagtgatg
P10415_BCL2-09          atgg----------------------------------------------
Q07817_BCL2L1-12        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-01        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-03        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-04        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-05        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-06        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-07        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-08        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-09        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-10        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-11        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-02        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-14        atgtctc--------------------agagcaaccgggagctggtggtt
Q07817_BCL2L1-15        atgtctc--------------------agagcaaccgggagctggtggtt
                                                                          

Q16548_BCL2A1-03        ggatatat---ttacaggctggctcaggactatc----------------
Q16548_BCL2A1-01        ggatatat---ttacaggctggctcaggactatc----------------
Q16548_BCL2A1-02        ggatatat---ttacaggctggctcaggactatc----------------
Q9HD36_BCL2L10-01       gcgcac--------cgagctgttgctggccgactac--------------
Q9HD36_BCL2L10-02       gcgcac--------cgagctgttgctggccgactac--------------
C8YZ26_MCL1-01          ggact---------caacctctactgtgggggggccggcttg--------
Q07820_MCL1-09          ggact---------caacctctactgtgggggggccggcttg--------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          ggact---------caacctctactgtgggggggccggcttg--------
B4DU51_MCL1-01          ggact---------caacctctactgtgggggggccggcttg--------
B4DLY8_MCL1-01          ggact---------caacctctactgtgggggggccggcttg--------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          ggact---------caacctctactgtgggggggccggcttg--------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ggact---------caacctctactgtgggggggccggcttg--------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgt--------
A0A7I2V383_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-08        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-07        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-06        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-05        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-04        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-03        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-02        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
A0A7I2V383_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-01        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
Q92843_BCL2L2-09        gactttgtaggttataagctgaggcagaagggttatgtctgt--------
P10415_BCL2-04          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-10          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-05          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-08          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-06          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-07          aagtacatccattataagctgtcgcagaggggctacgagtgg--------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-01        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-03        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-04        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-05        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-06        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-07        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-08        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-09        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-10        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-11        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-02        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-14        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
Q07817_BCL2L1-15        gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
                                                                          

Q16548_BCL2A1-03        ---------------------tgcagtgcgtcctacag------------
Q16548_BCL2A1-01        ---------------------tgcagtgcgtcctacag------------
Q16548_BCL2A1-02        ---------------------tgcagtgcgtcctacag------------
Q9HD36_BCL2L10-01       -----------------ctggggtactgcgcccgggaa------------
Q9HD36_BCL2L10-02       -----------------ctggggtactgcgcccgggaa------------
C8YZ26_MCL1-01          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
Q07820_MCL1-09          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DU51_MCL1-01          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DLY8_MCL1-01          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ----ggggccggcagcggcggcgccacccgcccgggagggcgacttttgg
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------ggagctggccccggggagggccca------
A0A7I2V383_BCL2L2-      --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-08        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-07        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-06        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-05        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-04        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-03        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-02        --------------------ggagctggccccggggagggccca------
A0A7I2V383_BCL2L2-      --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-01        --------------------ggagctggccccggggagggccca------
Q92843_BCL2L2-09        --------------------ggagctggccccggggagggccca------
P10415_BCL2-04          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-10          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-05          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-08          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-06          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-07          ----gatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccgc
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-01        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-03        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-04        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-05        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-06        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-07        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-08        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-09        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-10        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-11        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-02        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-14        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
Q07817_BCL2L1-15        tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          c-------------------------------------------------
Q07820_MCL1-09          ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          c-------------------------------------------------
B4DU51_MCL1-01          ctacggag------------------------------------------
B4DLY8_MCL1-01          ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-10          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-05          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-08          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-06          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-07          accgggcatcttctcctcccagcc--------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-01        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-03        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-04        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-05        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-06        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-07        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-08        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-09        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-10        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-11        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-02        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-14        agatggagacccccagtgccatca--------------------------
Q07817_BCL2L1-15        agatggagacccccagtgccatca--------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          gccagactcccggagggtcgcgcggccgccgc------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        ---------------------------------------------atacc
Q16548_BCL2A1-01        ---------------------------------------------atacc
Q16548_BCL2A1-02        ---------------------------------------------atacc
Q9HD36_BCL2L10-01       -----------------------------------------------ccc
Q9HD36_BCL2L10-02       -----------------------------------------------ccc
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
B4E3L8_MCL1-01          ---------------------atggaagccccggccgctgacgccatcat
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          ---------------------atggaagccccggccgctgacgccatcat
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          ---------------------atggaagccccggccgctgacgccatcat
Q07820_MCL1-03          cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          cgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcat
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-10          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-05          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-08          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-03          ---------------------------------------------atccc
A9QXG9_BCL2-01          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-06          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-07          ---------------------cgggcacacgccccatccagccgcatccc
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-01        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-03        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-04        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-05        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-06        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-07        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-08        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-09        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-10        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-11        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-02        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-14        ---------------------atggcaacc--------------catcct
Q07817_BCL2L1-15        ---------------------atggcaacc--------------catcct
                                                                          

Q16548_BCL2A1-03        acaacct-------------------------------------------
Q16548_BCL2A1-01        acaacct-------------------------------------------
Q16548_BCL2A1-02        acaacct-------------------------------------------
Q9HD36_BCL2L10-01       ggcacccc------------------------------------------
Q9HD36_BCL2L10-02       ggcacccc------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
B4E3L8_MCL1-01          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-03          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          gggacccg------------------------------------------
P10415_BCL2-10          gggacccg------------------------------------------
P10415_BCL2-05          gggacccg------------------------------------------
P10415_BCL2-08          gggacccg------------------------------------------
P10415_BCL2-03          agggttc-------------------------------------------
A9QXG9_BCL2-01          gggacccg------------------------------------------
P10415_BCL2-06          gggacccg------------------------------------------
P10415_BCL2-07          gggacccg------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        ggcacctg------------------------------------------
Q07817_BCL2L1-01        ggcacctg------------------------------------------
Q07817_BCL2L1-03        ggcacctg------------------------------------------
Q07817_BCL2L1-04        ggcacctg------------------------------------------
Q07817_BCL2L1-05        ggcacctg------------------------------------------
Q07817_BCL2L1-06        ggcacctg------------------------------------------
Q07817_BCL2L1-07        ggcacctg------------------------------------------
Q07817_BCL2L1-08        ggcacctg------------------------------------------
Q07817_BCL2L1-09        ggcacctg------------------------------------------
Q07817_BCL2L1-10        ggcacctg------------------------------------------
Q07817_BCL2L1-11        ggcacctg------------------------------------------
Q07817_BCL2L1-02        ggcacctg------------------------------------------
Q07817_BCL2L1-14        ggcacctg------------------------------------------
Q07817_BCL2L1-15        ggcacctg------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
B4E3L8_MCL1-01          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-03          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ggccggctgtcctgccgctgctggagttggtcggggaatctggtaataac
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
B4E3L8_MCL1-01          accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          accagtacggacgggtcactacccttgacgccgccgccagcagaggagga
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-03          accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
B4E3L8_MCL1-01          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-03          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-10          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-05          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-08          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-06          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-07          ---------------------------gtcgccaggacctcgcc------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-01        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-03        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-04        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-05        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-06        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-07        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-08        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-09        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-10        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-11        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-02        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-14        ---------------------------gcagacagccccgcggtgaatgg
Q07817_BCL2L1-15        ---------------------------gcagacagccccgcggtgaatgg
                                                                          

Q16548_BCL2A1-03        -ggatcaggtc----------------------------------caagc
Q16548_BCL2A1-01        -ggatcaggtc----------------------------------caagc
Q16548_BCL2A1-02        -ggatcaggtc----------------------------------caagc
Q9HD36_BCL2L10-01       -cgagccggcgccatccac-----------------------------gc
Q9HD36_BCL2L10-02       -cgagccggcgccatccac-----------------------------gc
C8YZ26_MCL1-01          ----------caccggcgccaaggacacaaagccaatg-----ggcaggt
Q07820_MCL1-09          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
B4E3L8_MCL1-01          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
Q07820_MCL1-06          ----------caccggcgccaaggacacaaagccaatg-----ggcaggt
B4DU51_MCL1-01          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
B4DLY8_MCL1-01          ------------------ccaaggacacaaagccaatg-----ggcaggt
B4DG83_MCL1-01          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
Q07820_MCL1-03          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
Q07820_MCL1-05          -----------------------------------atg-----ggcaggt
Q07820_MCL1-07          gggagcaggccaccggcgccaaggacacaaagccaatg-----ggcaggt
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      -gcagctgacc---------------------------------------
A0A7I2V383_BCL2L2-      -gcagctgacc---------------------------------------
Q92843_BCL2L2-08        -gcagctgacc---------------------------------------
Q92843_BCL2L2-07        -gcagctgacc---------------------------------------
Q92843_BCL2L2-06        -gcagctgacc---------------------------------------
Q92843_BCL2L2-05        -gcagctgacc---------------------------------------
Q92843_BCL2L2-04        -gcagctgacc---------------------------------------
Q92843_BCL2L2-03        -gcagctgacc---------------------------------------
Q92843_BCL2L2-02        -gcagctgacc---------------------------------------
A0A7I2V383_BCL2L2-      -gcagctgacc---------------------------------------
Q92843_BCL2L2-01        -gcagctgacc---------------------------------------
Q92843_BCL2L2-09        -gcagctgacc---------------------------------------
P10415_BCL2-04          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-10          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-05          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-08          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-06          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-07          -gctgcagaccccggctgcccccggcgccgccgcggggcctgcgctcagc
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-01        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-03        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-04        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-05        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-06        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-07        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-08        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-09        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-10        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-11        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-02        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-14        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
Q07817_BCL2L1-15        agccactggccacagcagcagtttggatgcccgggagg-------tgatc
                                                                          

Q16548_BCL2A1-03        aaaacgtccagagtgctaca-------aaatgttgcgttctcagtccaaa
Q16548_BCL2A1-01        aaaacgtccagagtgctaca-------aaatgttgcgttctcagtccaaa
Q16548_BCL2A1-02        aaaacgtccagagtgctaca-------aaatgttgcgttctcagtccaaa
Q9HD36_BCL2L10-01       ccgaggccgcc------------------gtgctgcg--ctccgcggccg
Q9HD36_BCL2L10-02       ccgaggccgcc------------------gtgctgcg--ctccgcggccg
C8YZ26_MCL1-01          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q07820_MCL1-09          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
B4E3L8_MCL1-01          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q07820_MCL1-06          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
B4DU51_MCL1-01          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
B4DLY8_MCL1-01          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
B4DG83_MCL1-01          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q07820_MCL1-03          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q07820_MCL1-05          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q07820_MCL1-07          ctggggccaccagcaggaaggcgctggagaccttacg--acgggttgggg
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      -------------cgctgcacc-----aagccatgcg--ggcagctggag
A0A7I2V383_BCL2L2-      -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-08        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-07        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-06        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-05        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-04        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-03        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-02        -------------cgctgcacc-----aagccatgcg--ggcagctggag
A0A7I2V383_BCL2L2-      -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-01        -------------cgctgcacc-----aagccatgcg--ggcagctggag
Q92843_BCL2L2-09        -------------cgctgcacc-----aagccatgcg--ggcagctggag
P10415_BCL2-04          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-10          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-05          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-08          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-06          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-07          ccggtgccacctgtggtccacc-----tgaccctccg--ccaggccggcg
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-01        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-03        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-04        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-05        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-06        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-07        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-08        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-09        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-10        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-11        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-02        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-14        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
Q07817_BCL2L1-15        cccatggca---gcagtaaagc-----aagcgctgag--ggaggcaggcg
                                                                          

Q16548_BCL2A1-03        aagaagtggaaaagaatctgaagtcatgcttggacaatgttaatgtt---
Q16548_BCL2A1-01        aagaagtggaaaagaatctgaagtcatgcttggacaatgttaatgtt---
Q16548_BCL2A1-02        aagaagtggaaaagaatctgaagtcatgcttggacaatgttaatgtt---
Q9HD36_BCL2L10-01       ccaggttacggcagattcaccggtcctttttctccgcc----tacctcgg
Q9HD36_BCL2L10-02       ccaggttacggcagattcaccggtcctttttctccgcc----tacctcgg
C8YZ26_MCL1-01          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaga
Q07820_MCL1-09          atggcgtgcagcgcaaccacgagacggccttccaa---------------
B4E3L8_MCL1-01          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-06          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DU51_MCL1-01          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DLY8_MCL1-01          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
B4DG83_MCL1-01          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-03          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-05          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q07820_MCL1-07          atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
Q92843_BCL2L2-10        ----------------------gcgcaccttctctgatctggcggctcag
A0A7I2V383_BCL2L2-      atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
A0A7I2V383_BCL2L2-      atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-08        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-07        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-06        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-05        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-04        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-03        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-02        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
A0A7I2V383_BCL2L2-      atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
Q92843_BCL2L2-01        atga----------------------------------------------
Q92843_BCL2L2-09        atgagttcgagacccgcttccggcgcaccttctctgatctggcggctcag
P10415_BCL2-04          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-10          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-05          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-08          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-06          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-07          acgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccag
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-01        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-03        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-04        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-05        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-06        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-07        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-08        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-09        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-10        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-11        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-02        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-14        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
Q07817_BCL2L1-15        acgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccag
                                                                          

Q16548_BCL2A1-03        ------gtgtccgtagacactgccagaacactattcaaccaagtgatgga
Q16548_BCL2A1-01        ------gtgtccgtagacactgccagaacactattcaaccaagtgatgga
Q16548_BCL2A1-02        ------gtgtccgtagacactgccagaacactattcaaccaagtgatgga
Q9HD36_BCL2L10-01       ct-------accccgggaaccgcttcg-agctggtggcgctgatggcgga
Q9HD36_BCL2L10-02       ct-------accccgggaaccgcttcg-agctggtggcgctgatggcgga
C8YZ26_MCL1-01          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-06          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DU51_MCL1-01          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DLY8_MCL1-01          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DG83_MCL1-01          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-03          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-05          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-07          ctggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q92843_BCL2L2-10        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
A0A7I2V383_BCL2L2-      ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
A0A7I2V383_BCL2L2-      ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-08        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-07        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-06        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-05        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-04        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-03        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-02        ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
A0A7I2V383_BCL2L2-      ctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        ctgcatgtgacccc------------------------------------
P10415_BCL2-04          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-10          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-05          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-08          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-06          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-07          ctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgga
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-01        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-03        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-04        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-05        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-06        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-07        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-08        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-09        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-10        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-11        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
Q07817_BCL2L1-02        ctccacatcaccccagggacagcatatcagagctttga------------
Q07817_BCL2L1-14        ctccacatcaccccagggacagcatatcagagctttga------------
Q07817_BCL2L1-15        ctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaa
                                                                          

Q16548_BCL2A1-03        a---aaggagtttgaagacggcatcattaactggggaagaattgtaacca
Q16548_BCL2A1-01        a---aaggagtttgaagacggcatcattaactggggaagaattgtaacca
Q16548_BCL2A1-02        a---aaggagtttgaagacggcatcattaactggggaagaattgtaacca
Q9HD36_BCL2L10-01       ttccgtgctctccgacagccccggccccacctggggcagagtggtgacgc
Q9HD36_BCL2L10-02       ttccgtgctctccgacagccccggccccacctggggcagagtggtgacgc
C8YZ26_MCL1-01          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          c---catgttttcagcgacagcgtaacaaactggggcaggattgtgactc
Q07820_MCL1-06          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
B4DU51_MCL1-01          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
B4DLY8_MCL1-01          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
B4DG83_MCL1-01          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
Q07820_MCL1-03          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
Q07820_MCL1-05          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
Q07820_MCL1-07          c---catgttttcagcgacggcgtaacaaactggggcaggattgtgactc
Q92843_BCL2L2-10        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
A0A7I2V383_BCL2L2-      t---gaactttttcaagggggccc---caactggggccgccttgtagcct
A0A7I2V383_BCL2L2-      t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-08        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-07        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-06        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-05        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-04        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-03        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-02        t---gaactttttcaagggggccc---caactggggccgccttgtagcct
A0A7I2V383_BCL2L2-      t---gaactttttcaagggggccc---caactggggccgccttgtagcct
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-10          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-05          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-08          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-06          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-07          g---gagctcttcagggacggggt---gaactgggggaggattgtggcct
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-01        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-03        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-04        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-05        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-06        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-07        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-08        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-09        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-10        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-11        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        t---gaactcttccgggatggggt---aaactggggtcgcattgtggcct
                                                                          

Q16548_BCL2A1-03        tatttgcatttgaagg---------tattctcatcaagaaacttctacga
Q16548_BCL2A1-01        tatttgcatttgaagg---------tattctcatcaagaaacttctacga
Q16548_BCL2A1-02        tatttgcatttgaagg---------tattctcatcaagaaacttctacga
Q9HD36_BCL2L10-01       tcgtgaccttcgcagg------gacgctgc-tggagaga-------gggc
Q9HD36_BCL2L10-02       tcgtgaccttcgcagg------gacgctgc-tggagaga-------gggc
C8YZ26_MCL1-01          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q07820_MCL1-06          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
B4DU51_MCL1-01          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
B4DLY8_MCL1-01          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
B4DG83_MCL1-01          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q07820_MCL1-03          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q07820_MCL1-05          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q07820_MCL1-07          tcatttcttttggtgcctttgtggctaaacacttgaaga-------ccat
Q92843_BCL2L2-10        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
A0A7I2V383_BCL2L2-      tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
A0A7I2V383_BCL2L2-      tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-08        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-07        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-06        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-05        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-04        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-03        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-02        tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
A0A7I2V383_BCL2L2-      tctttgtctttggggc------tgcactgtgtgctgaga-------gtgt
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-10          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-05          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-08          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-06          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-07          tctttgagttcggtgg------ggtcatgtgtgtggaga-------gcgt
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-01        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-03        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-04        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-05        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-06        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-07        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-08        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-09        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-10        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-11        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        ttttctccttcggcgg------ggcactgtgcgtggaaa-------gcgt
                                                                          

Q16548_BCL2A1-03        cagcaaattgccccggatgtggatacctataaggagatttcatat-----
Q16548_BCL2A1-01        cagcaaattgccccggatgtggatacctataaggagatttcatat-----
Q16548_BCL2A1-02        cagcaaattgccccggatgtggatacctataaggagatttcatat-----
Q9HD36_BCL2L10-01       cgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaag
Q9HD36_BCL2L10-02       cgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaag
C8YZ26_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q07820_MCL1-06          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
B4DU51_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
B4DLY8_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
B4DG83_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q07820_MCL1-03          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q07820_MCL1-05          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q07820_MCL1-07          aaaccaagaaagctgcatcgaaccattagcagaaagtatc----------
Q92843_BCL2L2-10        caacaaggag------atggaaccactggtgggacaagtgcagga-----
A0A7I2V383_BCL2L2-      caacaaggag------atggaaccactggtgggacaagtgcagga-----
A0A7I2V383_BCL2L2-      caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-08        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-07        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-06        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-05        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-04        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-03        caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-02        caacaaggag------atggaaccactggtgggacaagtgcagga-----
A0A7I2V383_BCL2L2-      caacaaggag------atggaaccactggtgggacaagtgcagga-----
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-10          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-05          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-08          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-06          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-07          caaccgggag------atgtcgcccctggtggacaacatcgccct-----
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-01        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-03        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-04        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-05        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-06        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-07        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-08        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-09        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-10        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-11        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        agacaaggag------atgcaggtattggtgagtcggatcgcagc-----
                                                                          

Q16548_BCL2A1-03        ---------------------------------tttgttgcggagttcat
Q16548_BCL2A1-01        ---------------------------------tttgttgcggagttcat
Q16548_BCL2A1-02        ---------------------------------tttgttgcggagttcat
Q9HD36_BCL2L10-01       gagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgct
Q9HD36_BCL2L10-02       gagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgct
C8YZ26_MCL1-01          ------------------------------------acagacgttctcgt
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          ------------------------------------acagacgttctcgt
Q07820_MCL1-06          ------------------------------------acagacgttctcgt
B4DU51_MCL1-01          ------------------------------------acagacgttctcgt
B4DLY8_MCL1-01          ------------------------------------acagacgttctcgt
B4DG83_MCL1-01          ------------------------------------acagacgttctcgt
Q07820_MCL1-03          ------------------------------------acagacgttctcgt
Q07820_MCL1-05          ------------------------------------acagacgttctcgt
Q07820_MCL1-07          ------------------------------------acagacgttctcgt
Q92843_BCL2L2-10        --------------------------------gtggatggtggcctacct
A0A7I2V383_BCL2L2-      --------------------------------gtggatggtggcctacct
A0A7I2V383_BCL2L2-      --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-08        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-07        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-06        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-05        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-04        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-03        --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-02        --------------------------------gtggatggtggcctacct
A0A7I2V383_BCL2L2-      --------------------------------gtggatggtggcctacct
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------gtggatgactgagtacct
P10415_BCL2-10          --------------------------------gtggatgactgagtacct
P10415_BCL2-05          --------------------------------gtggatgactgagtacct
P10415_BCL2-08          --------------------------------gtggatgactgagtacct
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------gtggatgactgagtacct
P10415_BCL2-06          --------------------------------gtggatgactgagtacct
P10415_BCL2-07          --------------------------------gtggatgactgagtacct
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-01        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-03        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-04        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-05        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-06        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-07        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-08        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-09        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-10        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-11        --------------------------------ttggatggccacttacct
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------ttggatggccacttacct
                                                                          

Q16548_BCL2A1-03        aat------------gaataacacaggagaatggataaggcaaaacggag
Q16548_BCL2A1-01        aat------------gaataacacaggagaatggataaggcaaaacggag
Q16548_BCL2A1-02        aat------------gaataacacaggagaatggataaggcaaaacggag
Q9HD36_BCL2L10-01       gagctcgcggctcatggggcagcaccgcgcctggctgcaggctcagggcg
Q9HD36_BCL2L10-02       gagctcgcggctcatggggcagcaccgcgcctggctgcaggctcagggcg
C8YZ26_MCL1-01          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q07820_MCL1-06          aag------------gacaaaacggga---ctggctagttaaacaaagag
B4DU51_MCL1-01          aag------------gacaaaacggga---ctggctagttaaacaaagag
B4DLY8_MCL1-01          aag------------gacaaaacggga---ctggctagttaaacaaagag
B4DG83_MCL1-01          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q07820_MCL1-03          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q07820_MCL1-05          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q07820_MCL1-07          aag------------gacaaaacggga---ctggctagttaaacaaagag
Q92843_BCL2L2-10        gga------------gacgcagctggctgactggatccacagcagtgggg
A0A7I2V383_BCL2L2-      gga------------gacgcagctggctgactggatccacagcagtgggg
A0A7I2V383_BCL2L2-      gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-08        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-07        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-06        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-05        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-04        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-03        gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-02        gga------------gacgcagctggctgactggatccacagcagtgggg
A0A7I2V383_BCL2L2-      gga------------gacgcagctggctgactggatccacagcagtgggg
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-10          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-05          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-08          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-03          -----------------------------------------------cag
A9QXG9_BCL2-01          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-06          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-07          gaa------------ccggcacctgcacacctggatccaggataacggag
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-01        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-03        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-04        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-05        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-06        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-07        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-08        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-09        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-10        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-11        gaa------------tgaccacctagagccttggatccaggagaacggcg
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        gaa------------tgaccacctagagccttggatccaggagaacggcg
                                                                          

Q16548_BCL2A1-03        gct-----------------------------------------------
Q16548_BCL2A1-01        gctg----------------------------------------------
Q16548_BCL2A1-02        gct-----------------------------------------------
Q9HD36_BCL2L10-01       gctg----------------------------------------------
Q9HD36_BCL2L10-02       gctg----------------------------------------------
C8YZ26_MCL1-01          gctg----------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          gctg----------------------------------------------
Q07820_MCL1-06          gctg----------------------------------------------
B4DU51_MCL1-01          gctg----------------------------------------------
B4DLY8_MCL1-01          gctg----------------------------------------------
B4DG83_MCL1-01          gctg----------------------------------------------
Q07820_MCL1-03          gctg----------------------------------------------
Q07820_MCL1-05          gctg----------------------------------------------
Q07820_MCL1-07          gctg----------------------------------------------
Q92843_BCL2L2-10        gctg----------------------------------------------
A0A7I2V383_BCL2L2-      gctg----------------------------------------------
A0A7I2V383_BCL2L2-      gctg----------------------------------------------
Q92843_BCL2L2-08        gctg----------------------------------------------
Q92843_BCL2L2-07        gctg----------------------------------------------
Q92843_BCL2L2-06        gctg----------------------------------------------
Q92843_BCL2L2-05        gctg----------------------------------------------
Q92843_BCL2L2-04        gctg----------------------------------------------
Q92843_BCL2L2-03        gctg----------------------------------------------
Q92843_BCL2L2-02        gctg----------------------------------------------
A0A7I2V383_BCL2L2-      gctg----------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          gctg----------------------------------------------
P10415_BCL2-10          gctg----------------------------------------------
P10415_BCL2-05          gctg----------------------------------------------
P10415_BCL2-08          gctg----------------------------------------------
P10415_BCL2-03          gcca----------------------------------------------
A9QXG9_BCL2-01          gctg----------------------------------------------
P10415_BCL2-06          gctg----------------------------------------------
P10415_BCL2-07          gctg----------------------------------------------
P10415_BCL2-09          ---a----------------------------------------------
Q07817_BCL2L1-12        gctg----------------------------------------------
Q07817_BCL2L1-01        gctg----------------------------------------------
Q07817_BCL2L1-03        gctg----------------------------------------------
Q07817_BCL2L1-04        gctg----------------------------------------------
Q07817_BCL2L1-05        gctg----------------------------------------------
Q07817_BCL2L1-06        gctg----------------------------------------------
Q07817_BCL2L1-07        gctg----------------------------------------------
Q07817_BCL2L1-08        gctg----------------------------------------------
Q07817_BCL2L1-09        gctg----------------------------------------------
Q07817_BCL2L1-10        gctg----------------------------------------------
Q07817_BCL2L1-11        gctg----------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        gctggctggattggtggtgcttctgctcagctcaccttagagtaatcatc
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        actgacggaggagactggggaggtcccatccttcccctgggctcagctgg
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      ------------------------ggagct--------------------
A0A7I2V383_BCL2L2-      ------------------------ggagct--------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        ------------------------ggtaagaagcttctcaatt-------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        ------------------------ggtatggagca---------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      ------------------------gttatcccagatcactgaagctgaga
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        gtccccagacctacacctgaaccccacgcctgtctggtgtttacggattg
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       ------ggtgagcacgcggcggacaccgggacacggggcgggacgggcag
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
A0A7I2V383_BCL2L2-      --------------------------------------------------
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        -------------------------------------------------c
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      tggctgatgaagtaatttgcagtgaaattttaagcgactgtgactctgct
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        aagctgccaccctttgggacctatcctgttttcatttctgctctcagctc
                                                                          

Q16548_BCL2A1-03        --------------------------gg----------------------
Q16548_BCL2A1-01        --------------------------gg----------------------
Q16548_BCL2A1-02        --------------------------gg----------------------
Q9HD36_BCL2L10-01       --------------------------ggatggcttttg----tcacttct
Q9HD36_BCL2L10-02       ccgggaagcgcccacgaggctggcacggatggcttttg----tcacttct
C8YZ26_MCL1-01          --------------------------ggatgggtttgt----ggagttct
Q07820_MCL1-09          --------------------------ggatgggtttgt----ggagttct
B4E3L8_MCL1-01          --------------------------ggatgggtttgt----ggagttct
Q07820_MCL1-06          --------------------------ggatgggtttgt----ggagttct
B4DU51_MCL1-01          --------------------------ggatgggtttgt----ggagttct
B4DLY8_MCL1-01          --------------------------ggatgggtttgt----ggagttct
B4DG83_MCL1-01          --------------------------ggatgggtttgt----ggagttct
Q07820_MCL1-03          --------------------------ggatgggtttgt----ggagttct
Q07820_MCL1-05          --------------------------ggatgggtttgt----ggagttct
Q07820_MCL1-07          --------------------------ggatgggtttgt----ggagttct
Q92843_BCL2L2-10        --------------------------ggcggagttcac----agctctat
A0A7I2V383_BCL2L2-      --------------------------ggaagctatcaa----agctcgag
A0A7I2V383_BCL2L2-      --------------------------ggaagctatcaa----agctcgag
Q92843_BCL2L2-08        --------------------------ggcggagttcac----agctctat
Q92843_BCL2L2-07        --------------------------gccgctctgcac----atccttct
Q92843_BCL2L2-06        --------------------------ggcggagttcac----agctctat
Q92843_BCL2L2-05        --------------------------ggcggagttcac----agctctat
Q92843_BCL2L2-04        actcttcaccctaccctctaccacaggacacatatccctgttagcattcc
Q92843_BCL2L2-03        --------------------------ggcggagttcac----agctctat
Q92843_BCL2L2-02        --------------------------ggcggagttcac----agctctat
A0A7I2V383_BCL2L2-      gcaagttccccagatcttgaggagctggaagctatcaa----agctcgag
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------g-----------------------
P10415_BCL2-10          --------------------------g-----------------------
P10415_BCL2-05          --------------------------g-----------------------
P10415_BCL2-08          --------------------------gacagaaactca----ggatctgt
P10415_BCL2-03          --------------------------ggatgcctttgt----ggaactgt
A9QXG9_BCL2-01          --------------------------ggatgcctttgt----ggaactgt
P10415_BCL2-06          --------------------------ggatgcctttgt----ggaactgt
P10415_BCL2-07          --------------------------ggatgcctttgt----ggaactgt
P10415_BCL2-09          --------------------------ggatgcctttgt----ggaactgt
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-03        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-04        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-05        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-06        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-07        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-08        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-09        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-10        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-11        --------------------------ggatacttttgt----ggaactct
Q07817_BCL2L1-02        -----------------------acaggatacttttgt----ggaactct
Q07817_BCL2L1-14        -----------------------acaggatacttttgt----ggaactct
Q07817_BCL2L1-15        tctggtctctgtggacctcacttacaggatacttttgt----ggaactct
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       tcaggaccccctttcca---------------------------------
Q9HD36_BCL2L10-02       tcaggaccccctttcca---------------------------------
C8YZ26_MCL1-01          tccaagtagaggaccta---------------------------------
Q07820_MCL1-09          tccatgtagaggaccta---------------------------------
B4E3L8_MCL1-01          tccatgtagaggaccta---------------------------------
Q07820_MCL1-06          tccatgtagaggaccta---------------------------------
B4DU51_MCL1-01          tccatgtagaggaccta---------------------------------
B4DLY8_MCL1-01          tccatgtagaggaccta---------------------------------
B4DG83_MCL1-01          tccatgtagaggaccta---------------------------------
Q07820_MCL1-03          tccatgtagaggaccta---------------------------------
Q07820_MCL1-05          tccatgtagaggaccta---------------------------------
Q07820_MCL1-07          tccatgtagaggaccta---------------------------------
Q92843_BCL2L2-10        acggggacggggccctggagg-----------------------------
A0A7I2V383_BCL2L2-      tcagggagatggaggaagaag-----------------------------
A0A7I2V383_BCL2L2-      tcagggagatggaggaagaag-----------------------------
Q92843_BCL2L2-08        acggggacggggccctggagg-----------------------------
Q92843_BCL2L2-07        gcaaagctggtctccaggggg-----------------------------
Q92843_BCL2L2-06        acggggacggggccctggagg-----------------------------
Q92843_BCL2L2-05        acggggacggggccctggagg-----------------------------
Q92843_BCL2L2-04        ccgggacctttagccaagagg-----------------------------
Q92843_BCL2L2-03        acggggacggggccctggagg-----------------------------
Q92843_BCL2L2-02        acggggacggggccctggagg-----------------------------
A0A7I2V383_BCL2L2-      tcagggagatggaggaagaag-----------------------------
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          tcaacagtaatgcctgttcccccacgcctgcagccttggcaaccaccata
P10415_BCL2-03          acggcccca-----------------------------------------
A9QXG9_BCL2-01          acggcccca-----------------------------------------
P10415_BCL2-06          acggcccca-----------------------------------------
P10415_BCL2-07          acggcccca-----------------------------------------
P10415_BCL2-09          acggcccca-----------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-03        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-04        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-05        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-06        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-07        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-08        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-09        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-10        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-11        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-02        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-14        atgggaacaatgcagcagccgagagcc-----------------------
Q07817_BCL2L1-15        atgggaacaatgcagcagccgagagcc-----------------------
                                                                          

Q16548_BCL2A1-03        -------------------------------------------gtatgtg
Q16548_BCL2A1-01        -------------------------------------------ggaaatg
Q16548_BCL2A1-02        -------------------------------------------gaaaatg
Q9HD36_BCL2L10-01       -----------------------------------------------ctg
Q9HD36_BCL2L10-02       -----------------------------------------------ctg
C8YZ26_MCL1-01          -------------------------------------------gaaggtg
Q07820_MCL1-09          -------------------------------------------gaaggtg
B4E3L8_MCL1-01          -------------------------------------------gaaggtg
Q07820_MCL1-06          -------------------------------------------gaaggtg
B4DU51_MCL1-01          -------------------------------------------gaaggtg
B4DLY8_MCL1-01          -------------------------------------------gaaggtg
B4DG83_MCL1-01          -------------------------------------------gaaggtg
Q07820_MCL1-03          -------------------------------------------gaaggtg
Q07820_MCL1-05          -------------------------------------------gaaggtg
Q07820_MCL1-07          -------------------------------------------gaaggtg
Q92843_BCL2L2-10        -------------------------------------------aggcgcg
A0A7I2V383_BCL2L2-      -------------------------------------------ctgagaa
A0A7I2V383_BCL2L2-      -------------------------------------------ctgagaa
Q92843_BCL2L2-08        -------------------------------------------aggcgcg
Q92843_BCL2L2-07        -------------------------------------------aaga---
Q92843_BCL2L2-06        -------------------------------------------aggcgcg
Q92843_BCL2L2-05        -------------------------------------------aggcgcg
Q92843_BCL2L2-04        -------------------------------------------agctgca
Q92843_BCL2L2-03        -------------------------------------------aggcgcg
Q92843_BCL2L2-02        -------------------------------------------aggcgcg
A0A7I2V383_BCL2L2-      -------------------------------------------ctgagaa
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          -------------------------------------------gtaggtg
P10415_BCL2-10          -------------------------------------------gtaggtg
P10415_BCL2-05          -------------------------------------ctttacat-----
P10415_BCL2-08          ctactgcctgcctctatgaacttgactactctaggtacctcgcataagtg
P10415_BCL2-03          -------------------------------------------gcatgcg
A9QXG9_BCL2-01          -------------------------------------------gcatgcg
P10415_BCL2-06          -------------------------------------------gcatgcg
P10415_BCL2-07          -------------------------------------------gcatgcg
P10415_BCL2-09          -------------------------------------------gcatgcg
Q07817_BCL2L1-12        ----------------------------------------------ggtg
Q07817_BCL2L1-01        -------------------------------------------gaaaggg
Q07817_BCL2L1-03        -------------------------------------------gaaaggg
Q07817_BCL2L1-04        -------------------------------------------gaaaggg
Q07817_BCL2L1-05        -------------------------------------------gaaaggg
Q07817_BCL2L1-06        -------------------------------------------gaaaggg
Q07817_BCL2L1-07        -------------------------------------------gaaaggg
Q07817_BCL2L1-08        -------------------------------------------gaaaggg
Q07817_BCL2L1-09        -------------------------------------------gaaaggg
Q07817_BCL2L1-10        -------------------------------------------gaaaggg
Q07817_BCL2L1-11        -------------------------------------------gaaaggg
Q07817_BCL2L1-02        -------------------------------------------gaaaggg
Q07817_BCL2L1-14        -------------------------------------------gaaaggg
Q07817_BCL2L1-15        -------------------------------------------gaaaggg
                                                                          

Q16548_BCL2A1-03        tgat----------------------------------------------
Q16548_BCL2A1-01        gc------------------------------------------------
Q16548_BCL2A1-02        gctt----------------------------------------------
Q9HD36_BCL2L10-01       gctttttggagaaaacagctggtcc-------------------------
Q9HD36_BCL2L10-02       gctttttggagaaaacagctggtcc-------------------------
C8YZ26_MCL1-01          gcatcaggaat---------------------------------------
Q07820_MCL1-09          gcatcaggaat---------------------------------------
B4E3L8_MCL1-01          gcatcaggaat---------------------------------------
Q07820_MCL1-06          gcatcaggaat---------------------------------------
B4DU51_MCL1-01          gcatcaggaat---------------------------------------
B4DLY8_MCL1-01          gcatcaggaat---------------------------------------
B4DG83_MCL1-01          gcatcaggaat---------------------------------------
Q07820_MCL1-03          gcatcaggaat---------------------------------------
Q07820_MCL1-05          gcatcaggaat---------------------------------------
Q07820_MCL1-07          gcatcaggaat---------------------------------------
Q92843_BCL2L2-10        gcgtctgcgggaggggaactgggca-------------------------
A0A7I2V383_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A7I2V383_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
Q92843_BCL2L2-08        gcgtctgcgggaggggaactgggca-------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        gcgtctgcgggaggggaactgggca-------------------------
Q92843_BCL2L2-05        gcgtctgcgggaggggaactgggca-------------------------
Q92843_BCL2L2-04        gggaccatgg----------------------------------------
Q92843_BCL2L2-03        gcgtctgcgggaggggaactgggca-------------------------
Q92843_BCL2L2-02        gcgtctgcgggaggggaactgggca-------------------------
A0A7I2V383_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          cacttggtgatgtga-----------------------------------
P10415_BCL2-10          cacttggtgatgtga-----------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          gactcacacttgtgactggcttgtt-------------------------
P10415_BCL2-03          gcctctg---tttgatttctcctgg-------------------------
A9QXG9_BCL2-01          gcctctg---tttgatttctcctgg-------------------------
P10415_BCL2-06          gcctctg---tttgatttctcctgg-------------------------
P10415_BCL2-07          gcctctg---tttgatttctcctgg-------------------------
P10415_BCL2-09          gcctctg---tttgatttctcctgg-------------------------
Q07817_BCL2L1-12        ccaga-----------tgccagttt-------------------------
Q07817_BCL2L1-01        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-03        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-04        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-05        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-06        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-07        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-08        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-09        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-10        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-11        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-02        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-14        ccaggaacgcttcaaccgctggttc-------------------------
Q07817_BCL2L1-15        ccaggaacgcttcaaccgctggttc-------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      ctccaggcaatgctggcccggtgatcatgtccattgaggagaagatggag
A0A7I2V383_BCL2L2-      ctccaggcaatgctggcccggtgatcatgtccattgaggagaagatggag
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      ctccaggcaatgctggcccggtgatcatgtccattgaggagaagatggag
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A7I2V383_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      agaagagctggaagctcactttcatggctgtggttcagtcaaccgtgtta
A0A7I2V383_BCL2L2-      agaagagctggaagctcactttcatggctgtggttcagtcaaccgtgtta
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      agaagagctggaagctcactttcatggctgtggttcagtcaaccgtgtta
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        ---------------------------------------------ggaaa
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        ---------------------------------------------tgtaa
Q9HD36_BCL2L10-01       ------------------------------------------------ag
Q9HD36_BCL2L10-02       ------------------------------------------------ag
C8YZ26_MCL1-01          -----------------------------------------gtgctgctg
Q07820_MCL1-09          -----------------------------------------gtgctgctg
B4E3L8_MCL1-01          -----------------------------------------gtgctgctg
Q07820_MCL1-06          -----------------------------------------gtgctgctg
B4DU51_MCL1-01          -----------------------------------------gtgctgctg
B4DLY8_MCL1-01          -----------------------------------------gtgctgctg
B4DG83_MCL1-01          -----------------------------------------gtgctgctg
Q07820_MCL1-03          -----------------------------------------gtgctgctg
Q07820_MCL1-05          -----------------------------------------gtgctgctg
Q07820_MCL1-07          -----------------------------------------gtgctgctg
Q92843_BCL2L2-10        --------------------------------------tcagtgaggaca
A0A7I2V383_BCL2L2-      ccatactgtgtgacaaatttagtggccatcccaaagggtttgcgtatata
A0A7I2V383_BCL2L2-      ccatactgtgtgacaaatttagtggccatcccaaagggtttgcgtatata
Q92843_BCL2L2-08        --------------------------------------tcagtgaggaca
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------tcagtgaggaca
Q92843_BCL2L2-05        --------------------------------------tcagtgaggaca
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------tcagtgaggaca
Q92843_BCL2L2-02        --------------------------------------tcagtgaggaca
A0A7I2V383_BCL2L2-      ccatactgtgtgacaaatttagtggccatcccaaagggtttgcgtatata
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------acactaagcatg
P10415_BCL2-03          --------------------------------------ctgtctctgaag
A9QXG9_BCL2-01          --------------------------------------ctgtctctgaag
P10415_BCL2-06          --------------------------------------ctgtctctgaag
P10415_BCL2-07          --------------------------------------ctgtctctgaag
P10415_BCL2-09          --------------------------------------ctgtctctgaag
Q07817_BCL2L1-12        --------------------------------------taga--------
Q07817_BCL2L1-01        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-03        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-04        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-05        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-06        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-07        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-08        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-09        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-10        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-11        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-02        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-14        --------------------------------------ctgacgggcatg
Q07817_BCL2L1-15        --------------------------------------ctgacgggcatg
                                                                          

Q16548_BCL2A1-03        aattcttcattgttctttcctgtgaaat------------agaaattgag
Q16548_BCL2A1-01        acaatcacacacctatg-ctggtagagtcagtggcccacaagaagaggaa
Q16548_BCL2A1-02        agaagtttgaacctaaatctggctggatgacttttctagaagttacagga
Q9HD36_BCL2L10-01       gcttttc----tgtcatgcttgttaacaacagccttcatttatctctgga
Q9HD36_BCL2L10-02       gcttttc----tgtcatgcttgttaacaacagccttcatttatctctgga
C8YZ26_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q07820_MCL1-09          gcttttgcaggtgttgctggagtaggagctggtttg--------------
B4E3L8_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q07820_MCL1-06          gcttttgcaggtgttgctggagtaggagctggtttg--------------
B4DU51_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttg--------------
B4DLY8_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttg--------------
B4DG83_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q07820_MCL1-03          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q07820_MCL1-05          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q07820_MCL1-07          gcttttgcaggtgttgctggagtaggagctggtttg--------------
Q92843_BCL2L2-10        gtgctgacgggggccgtggcactgggggccctggtatggagcacactctt
A0A7I2V383_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttg------gccttaga
A0A7I2V383_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttg------gccttaga
Q92843_BCL2L2-08        gtgctgacgggggccgtggcactgggggccctggta------actgtagg
Q92843_BCL2L2-07        ----------------------tgggggctctga----------------
Q92843_BCL2L2-06        gtgctgacgggggccgtggcactgggggccctggta------actgtagg
Q92843_BCL2L2-05        gtgctgacgggggccgtggcactgggggccctggta------actgtagg
Q92843_BCL2L2-04        -----------------------------ccaggtt------accaaaat
Q92843_BCL2L2-03        gtgctgacgggggccgtggcactgggggccctggta------actgtagg
Q92843_BCL2L2-02        gtgctgacgggggccgtggcactgggggccctggta------actgtagg
A0A7I2V383_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttg------gccttaga
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          ---------------------gtctgggc---------------------
P10415_BCL2-10          ---------------------gtctgggc---------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          atgtcttcaaggttcatccatgttttggcctgtgtc------acagcttc
P10415_BCL2-03          actctgctcagtttggccctggtgggagcttgcatc------accctggg
A9QXG9_BCL2-01          actctgctcagtttggccctggtgggagcttgcatc------accctggg
P10415_BCL2-06          actctgctcagtttggccctggtgggagcttgcatc------accctggg
P10415_BCL2-07          actctgctcagtttggccctggtgggagcttgcatc------accctggg
P10415_BCL2-09          actctgctcagtttggccctggtgggagcttgcatc------accctggg
Q07817_BCL2L1-12        -------------------tt------------------------ctggc
Q07817_BCL2L1-01        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-03        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-04        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-05        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-06        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-07        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-08        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-09        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-10        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-11        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-02        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-14        actgtggccggcgtggttctg------------------------ctggg
Q07817_BCL2L1-15        actgtggccggcgtggttctg------------------------ctggg
                                                                          

Q16548_BCL2A1-03        aatttccttgcta------------------------gttaa--------
Q16548_BCL2A1-01        aatggctttgtaa-------------------------------------
Q16548_BCL2A1-02        aagatctgtgaaatgctatctctcctgaagcaatactgttga--------
Q9HD36_BCL2L10-01       cacgattattatga------------------------------------
Q9HD36_BCL2L10-02       cacgattattatgagttttaaaacttttaacccgcttctacctgcccaac
C8YZ26_MCL1-01          -gcatatctaaaaagatag-------------------------------
Q07820_MCL1-09          -gcatatctaataagatagccttactgtaa--------------------
B4E3L8_MCL1-01          -gcatatctaataagatag-------------------------------
Q07820_MCL1-06          -gcatatctaataagatag-------------------------------
B4DU51_MCL1-01          -gcatatctaataagatag-------------------------------
B4DLY8_MCL1-01          -gcatatctaataagatag-------------------------------
B4DG83_MCL1-01          -gcatatctaataagatag-------------------------------
Q07820_MCL1-03          -gcatatctaataagatag-------------------------------
Q07820_MCL1-05          -gcatatctaataagatag-------------------------------
Q07820_MCL1-07          -gcatatctaataagatag-------------------------------
Q92843_BCL2L2-10        caccctaccctctaccacaggacaca------------------------
A0A7I2V383_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
A0A7I2V383_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
Q92843_BCL2L2-08        ggccttttttgctagcaagtga----------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        ggccttttttgctagcaagtga----------------------------
Q92843_BCL2L2-05        ggccttttttgctagcaagtga----------------------------
Q92843_BCL2L2-04        gccctgctctga--------------------------------------
Q92843_BCL2L2-03        ggccttttttgctagcaagtga----------------------------
Q92843_BCL2L2-02        ggccttttttgctagcaagtga----------------------------
A0A7I2V383_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          -------------------tga----------------------------
P10415_BCL2-10          -------------------tga----------------------------
P10415_BCL2-05          ------------------gtga----------------------------
P10415_BCL2-08          cttcattttgaaggctgaatga----------------------------
P10415_BCL2-03          tgcctatctgggccacaagtga----------------------------
A9QXG9_BCL2-01          tgcctatctgagccacaagtga----------------------------
P10415_BCL2-06          tgcctatctgggccacaagtga----------------------------
P10415_BCL2-07          tgcctatctgggccacaagtga----------------------------
P10415_BCL2-09          tgcctatctgggccacaagtga----------------------------
Q07817_BCL2L1-12        tccacc-----------actga----------------------------
Q07817_BCL2L1-01        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-03        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-04        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-05        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-06        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-07        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-08        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-09        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-10        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-11        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-02        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-14        ctcactcttcagtcggaaatga----------------------------
Q07817_BCL2L1-15        ctcactcttcagtcggaaatga----------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       tgtga---------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        --------------------------------------------------
A0A7I2V383_BCL2L2-      acagaccaggcatcagcacaacagaccggggttttccacgagcccgctac
A0A7I2V383_BCL2L2-      acagaccaggcatcagcacaacagaccggggttttccacgagcccgctac
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      acagaccaggcatcagcacaacagaccggggttttccacgagcccgctac
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        -----------------------------------------------tat
A0A7I2V383_BCL2L2-      cgcgcccggaccaccaactacaacagctcccgctctcgattctacagtgg
A0A7I2V383_BCL2L2-      cgcgcccggaccaccaactacaacagctcccgctctcgattctacagtgg
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      cgcgcccggaccaccaactacaacagctcccgctctcgattctacagtgg
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
Q16548_BCL2A1-02        --------------------------------------------------
Q9HD36_BCL2L10-01       --------------------------------------------------
Q9HD36_BCL2L10-02       --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
Q07820_MCL1-09          --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
Q07820_MCL1-06          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
Q07820_MCL1-03          --------------------------------------------------
Q07820_MCL1-05          --------------------------------------------------
Q07820_MCL1-07          --------------------------------------------------
Q92843_BCL2L2-10        ccctgttagcattccccgggacctttagccaagaggagctgcagggacca
A0A7I2V383_BCL2L2-      ttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcga
A0A7I2V383_BCL2L2-      ttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcga
Q92843_BCL2L2-08        --------------------------------------------------
Q92843_BCL2L2-07        --------------------------------------------------
Q92843_BCL2L2-06        --------------------------------------------------
Q92843_BCL2L2-05        --------------------------------------------------
Q92843_BCL2L2-04        --------------------------------------------------
Q92843_BCL2L2-03        --------------------------------------------------
Q92843_BCL2L2-02        --------------------------------------------------
A0A7I2V383_BCL2L2-      ttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcga
Q92843_BCL2L2-01        --------------------------------------------------
Q92843_BCL2L2-09        --------------------------------------------------
P10415_BCL2-04          --------------------------------------------------
P10415_BCL2-10          --------------------------------------------------
P10415_BCL2-05          --------------------------------------------------
P10415_BCL2-08          --------------------------------------------------
P10415_BCL2-03          --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
P10415_BCL2-06          --------------------------------------------------
P10415_BCL2-07          --------------------------------------------------
P10415_BCL2-09          --------------------------------------------------
Q07817_BCL2L1-12        --------------------------------------------------
Q07817_BCL2L1-01        --------------------------------------------------
Q07817_BCL2L1-03        --------------------------------------------------
Q07817_BCL2L1-04        --------------------------------------------------
Q07817_BCL2L1-05        --------------------------------------------------
Q07817_BCL2L1-06        --------------------------------------------------
Q07817_BCL2L1-07        --------------------------------------------------
Q07817_BCL2L1-08        --------------------------------------------------
Q07817_BCL2L1-09        --------------------------------------------------
Q07817_BCL2L1-10        --------------------------------------------------
Q07817_BCL2L1-11        --------------------------------------------------
Q07817_BCL2L1-02        --------------------------------------------------
Q07817_BCL2L1-14        --------------------------------------------------
Q07817_BCL2L1-15        --------------------------------------------------
                                                                          

Q16548_BCL2A1-03        ------------------------------
Q16548_BCL2A1-01        ------------------------------
Q16548_BCL2A1-02        ------------------------------
Q9HD36_BCL2L10-01       ------------------------------
Q9HD36_BCL2L10-02       ------------------------------
C8YZ26_MCL1-01          ------------------------------
Q07820_MCL1-09          ------------------------------
B4E3L8_MCL1-01          ------------------------------
Q07820_MCL1-06          ------------------------------
B4DU51_MCL1-01          ------------------------------
B4DLY8_MCL1-01          ------------------------------
B4DG83_MCL1-01          ------------------------------
Q07820_MCL1-03          ------------------------------
Q07820_MCL1-05          ------------------------------
Q07820_MCL1-07          ------------------------------
Q92843_BCL2L2-10        tggccaggttaccaaaatgccctgctctga
A0A7I2V383_BCL2L2-      catcatggt-------attccccttactaa
A0A7I2V383_BCL2L2-      catcatggt-------attccccttactaa
Q92843_BCL2L2-08        ------------------------------
Q92843_BCL2L2-07        ------------------------------
Q92843_BCL2L2-06        ------------------------------
Q92843_BCL2L2-05        ------------------------------
Q92843_BCL2L2-04        ------------------------------
Q92843_BCL2L2-03        ------------------------------
Q92843_BCL2L2-02        ------------------------------
A0A7I2V383_BCL2L2-      catcatggt-------attccccttactaa
Q92843_BCL2L2-01        ------------------------------
Q92843_BCL2L2-09        ------------------------------
P10415_BCL2-04          ------------------------------
P10415_BCL2-10          ------------------------------
P10415_BCL2-05          ------------------------------
P10415_BCL2-08          ------------------------------
P10415_BCL2-03          ------------------------------
A9QXG9_BCL2-01          ------------------------------
P10415_BCL2-06          ------------------------------
P10415_BCL2-07          ------------------------------
P10415_BCL2-09          ------------------------------
Q07817_BCL2L1-12        ------------------------------
Q07817_BCL2L1-01        ------------------------------
Q07817_BCL2L1-03        ------------------------------
Q07817_BCL2L1-04        ------------------------------
Q07817_BCL2L1-05        ------------------------------
Q07817_BCL2L1-06        ------------------------------
Q07817_BCL2L1-07        ------------------------------
Q07817_BCL2L1-08        ------------------------------
Q07817_BCL2L1-09        ------------------------------
Q07817_BCL2L1-10        ------------------------------
Q07817_BCL2L1-11        ------------------------------
Q07817_BCL2L1-02        ------------------------------
Q07817_BCL2L1-14        ------------------------------
Q07817_BCL2L1-15        ------------------------------
                                                      

© 1998-2021Legal notice