Dataset for CDS MCL-1 of organism Monodon monoceros

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4V5P8C2_MCL1-01      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
A0A4V5P8C2_MCL1-02      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
                        **************************************************

A0A4V5P8C2_MCL1-01      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa
A0A4V5P8C2_MCL1-02      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa
                        **************************************************

A0A4V5P8C2_MCL1-01      ggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtaggg
A0A4V5P8C2_MCL1-02      ggcggctttt----------------------------------------
                        **********                                        

A0A4V5P8C2_MCL1-01      ggaggggaagccggcgaggtgattggcggaagcgccggcccgagcccccc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      ggccactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattg
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      gcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      gcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggtctc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      cgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgag
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      gccagtaacagcccgggcaaggacggctcactcccctcgacgccgccccc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A4V5P8C2_MCL1-02      --------------------------------------------------
                                                                          

A0A4V5P8C2_MCL1-01      ctcgatacctccgggagcaggcaaccggcaccaaggacgcgaagccactg
A0A4V5P8C2_MCL1-02      -------------------ggcaaccggcaccaaggacgcgaagccactg
                                           *******************************

A0A4V5P8C2_MCL1-01      ggcgggtctggggccgccagccggaaagcgttagagaccctgcgacgggt
A0A4V5P8C2_MCL1-02      ggcgggtctggggccgccagccggaaagcgttagagaccctgcgacgggt
                        **************************************************

A0A4V5P8C2_MCL1-01      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc
A0A4V5P8C2_MCL1-02      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc
                        **************************************************

A0A4V5P8C2_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A4V5P8C2_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
                        **************************************************

A0A4V5P8C2_MCL1-01      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A4V5P8C2_MCL1-02      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
                        **************************************************

A0A4V5P8C2_MCL1-01      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
A0A4V5P8C2_MCL1-02      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
                        **************************************************

A0A4V5P8C2_MCL1-01      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A4V5P8C2_MCL1-02      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
                        **************************************************

A0A4V5P8C2_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A4V5P8C2_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
                        **************************************************

A0A4V5P8C2_MCL1-01      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A4V5P8C2_MCL1-02      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
                        **************************************************

A0A4V5P8C2_MCL1-01      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
A0A4V5P8C2_MCL1-02      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
                        **************************************************

A0A4V5P8C2_MCL1-01      agatag
A0A4V5P8C2_MCL1-02      agatag
                        ******

© 1998-2021Legal notice