Dataset for CDS BCL2L2 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P70345_BCL2L2-01      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
D3Z5F7_BCL2L2-01      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
P70345_BCL2L2-05      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
                                                                        

P70345_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
D3Z5F7_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
P70345_BCL2L2-05      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
                                                                        

P70345_BCL2L2-01      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
D3Z5F7_BCL2L2-01      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
P70345_BCL2L2-05      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
                                                                        

P70345_BCL2L2-01      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
D3Z5F7_BCL2L2-01      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
P70345_BCL2L2-05      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
                                                                        

P70345_BCL2L2-01      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
D3Z5F7_BCL2L2-01      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
P70345_BCL2L2-05      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
                                                                        

P70345_BCL2L2-01      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
D3Z5F7_BCL2L2-01      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
P70345_BCL2L2-05      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
                                                                        

P70345_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
P70345_BCL2L2-03      ------------------------------------------atggagcc
P70345_BCL2L2-04      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
D3Z5F7_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
P70345_BCL2L2-05      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
                                                                ********

P70345_BCL2L2-01      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-03      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-04      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
D3Z5F7_BCL2L2-01      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-05      t-------------------------------------------------
                      *                                                 

P70345_BCL2L2-01      tggctgactggatccacagcagtgggggctggg-----------------
P70345_BCL2L2-03      tggctgactggatccacagcagtgggggctggg-----------------
P70345_BCL2L2-04      tggctgactggatccacagcagtgggggctggg-----------------
D3Z5F7_BCL2L2-01      tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaa
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      --------------------------------------------------
D3Z5F7_BCL2L2-01      gctcgagtcagggagatggaggaagaggctgagaagctaaaggagctaca
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      --------------------------------------------------
D3Z5F7_BCL2L2-01      aaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctg
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      ------------------------cggagttcacagctc-----------
P70345_BCL2L2-03      ------------------------cggagttcacagctc-----------
P70345_BCL2L2-04      ----------------------taagaagttctcaattgctgctctccgc
D3Z5F7_BCL2L2-01      gcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgctct
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      atccc---------------------------------------------
D3Z5F7_BCL2L2-01      atctacgttggcaatgtggactatggtgcaacagcagaagagctggaagc
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      --------------------------------------------------
D3Z5F7_BCL2L2-01      ccattttcatggctgtggttcagtcaaccgtgttactatactctgtgaca
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      -----------------------tatacggggacggggccctggaggagg
P70345_BCL2L2-03      -----------------------tatacggggacggggccctggaggagg
P70345_BCL2L2-04      -----------------------tctacaaagttggtcttcatgggaaaa
D3Z5F7_BCL2L2-01      aatttagtggccatcccaaagggtttgcatatatagagttctcggacaaa
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      ca----------------------------cggcgtctgcgggaggg---
P70345_BCL2L2-03      ca----------------------------cggcgtctgcgggaggg---
P70345_BCL2L2-04      ta----------------------------gggcctctgatgggagg---
D3Z5F7_BCL2L2-01      gagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      --------------------------------------------------
D3Z5F7_BCL2L2-01      acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaa
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      --------------------------------------------------
P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-04      --------------------------------------------------
D3Z5F7_BCL2L2-01      cagaccggggtttcccgcgctcccgataccgtgcccggactaccaactac
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      ---------------gaactgggcatcagtgaggacagtgctgacggggg
P70345_BCL2L2-03      ---------------gaactgggcatcagtgaggacagtgctgacggggg
P70345_BCL2L2-04      --------------------------------------------ctgggg
D3Z5F7_BCL2L2-01      aacagctcccgatctcgattctacagtggttttaacagcaggccccgggg
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      ccgtggcactgggggccctggtaactgtaggggccttttttgctagcaag
P70345_BCL2L2-03      ccgtggcactgggggccctggtaactgtaggggccttttttgctagcaag
P70345_BCL2L2-04      ttgtgctgggaaggg-ctga------------------------------
D3Z5F7_BCL2L2-01      tcgaatctacagggg-ccgggctagagcgacatcatggtattccccttac
P70345_BCL2L2-05      --------------------------------------------------
                                                                        

P70345_BCL2L2-01      tga
P70345_BCL2L2-03      tga
P70345_BCL2L2-04      ---
D3Z5F7_BCL2L2-01      taa
P70345_BCL2L2-05      ---
                         

© 1998-2021Legal notice