Dataset for CDS BCL2L2 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
                                                                        

P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
                                                                        

P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
                                                                        

P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
                                                                        

P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
                                                                        

P70345_BCL2L2-02      --------------------------------------------------
P70345_BCL2L2-01      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
                                                                        

P70345_BCL2L2-02      ------------------------------------------atggagcc
P70345_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
                                                                ********

P70345_BCL2L2-02      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-01      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
                      **************************************************

P70345_BCL2L2-02      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
P70345_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
                      **************************************************

P70345_BCL2L2-02      tacggggacggggccctggaggaggcacggcgtctgcgggaggggaactg
P70345_BCL2L2-01      tacggggacggggccctggaggaggcacggcgtctgcgggaggggaactg
                      **************************************************

P70345_BCL2L2-02      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
P70345_BCL2L2-01      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
                      **************************************************

P70345_BCL2L2-02      taactgtaggggccttttttgctagcaagtga
P70345_BCL2L2-01      taactgtaggggccttttttgctagcaagtga
                      ********************************

© 1998-2020Legal notice