Dataset for CDS BCL2L2 of organism Mus musculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D3Z5F7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggcaatgtggactatggtgcaacagcagaag
agctggaagcccattttcatggctgtggttcagtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgatacc
gtgcccggactaccaactacaacagctcccgatctcgattctacagtggttttaacagcaggccccggggtcgaatctac
aggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2022Legal notice