Dataset for CDS BCL-2-like of organism Chelonoidis abingdonii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C0G2Q6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgagagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttctccaaatctctctccccctcctgctactgggacctcatctg
accatgctgggctggtctctttgcctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctg
cacccagcaccgcaggctgttctcttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcagtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaatttggtggtgtgatgtgcgtggagagcgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgaatacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattatacggcaggaacatgaggcctgtgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcatgcatcaccctgggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C0G393_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2A1 (length=528 residues).
atggaaagctctgagtactgctatgtttactatttagtccaagattatctgaaatacattcttcaggaaccacagcttgg
accagctccaagcagagttgctcatgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagaaagtctgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattatttctaagaagcttcaagaacacag
agttcagcttacaggagaaaataaaaagcagatttcttatttcatcacggagtacattataaacaccaaggctgagtgga
tagaggcaaatggaggttgggaaaatggcttcctaactatgtttgaggaaaaacgatcatggctgtccttattcaatatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtactattga
>gnl|bcl2dbcds|A0A8C0GRW6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=MCL-1 (length=579 residues).
catgttggcgttaaagcggaacgcggtgatcgcctcaacttgtactgcgggggcggccacgctgccccctccgcgccggc
ctccccagcggcgcggggacccctccgccccggccctgcggaggagggccgggccccgcgcatggagaaggcgctggaga
cgctgcggagggtcggcgacggcgtcattgagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaag
aatgaggatgatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcag
ggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagctt
agcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C0IVL6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
tgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaacg
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgagatatcggagggctttcagtgacctcacttccca
actccatatcacccctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcgtggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
© 1998-2022Legal notice