Dataset for CDS BCL-2-like of organism Chelonoidis abingdonii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C0G393_BCL2A1-      -atggaaagctctg------------------------------------
A0A8C0GRW6_MCL1-01      catgttggcgtt------------------aaagcggaacgcggtgatcg
A0A8C0G2Q6_BCL2-01      -atggctcatcctgggagaagaggctatgataaccgagagatagtgctga
A0A8C0IVL6_BCL2L1-      -atgtcgaacac------------------taacagggaattagtgattg

A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A8C0GRW6_MCL1-01      cctc-----------aacttgtactgcgggg-------------------
A0A8C0G2Q6_BCL2-01      agtacatccattacaaactgtcacagaggggatatgattgggct------
A0A8C0IVL6_BCL2L1-      actttctctcctacaagctatcgcagaggggatacagctggagtcggttt

A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      ------gccaatgaaaacagaggaccagtttctccaaatctctctccccc
A0A8C0IVL6_BCL2L1-      gaaggggaggatgagatc--aggactgattctgcagaa------------

A0A8C0G393_BCL2A1-      ----agtactgctatgtttactatttagtccaagattatct---------
A0A8C0GRW6_MCL1-01      ----gcggccacg-------ctgccccctccgcgccggcctcc-------
A0A8C0G2Q6_BCL2-01      tcctgctactgggacctcatctgaccatgctgggctggtctctttgcctc
A0A8C0IVL6_BCL2L1-      ----gaggctgagatggcaagtgtccctaatgggagtccatcctggcatc
                                *            *           *      *         

A0A8C0G393_BCL2A1-      ---------------------------------------gaaatacattc
A0A8C0GRW6_MCL1-01      ------ccagcggcgcgg------ggacccctccgccccgg--------c
A0A8C0G2Q6_BCL2-01      ctg-----agccccctggctc----ggctgctg---ctagtaacgtgccc
A0A8C0IVL6_BCL2L1-      cgggtgccagccacatagtgaatggggctgctgggcacagtaacag---c
                                                               *         *

A0A8C0G393_BCL2A1-      ttcaggaaccacagcttggaccagctccaagcagagttgctcatgtc-tt
A0A8C0GRW6_MCL1-01      cctgcggaggagggccgggccccgcgcatggagaaggcgctggagacgct
A0A8C0G2Q6_BCL2-01      cttggtg---atgggctgcacccagcaccgcaggctgttctcttggctct
A0A8C0IVL6_BCL2L1-      cttgaagcccatgaaagggttccagcaacgggagtgaggc---aggcgct
                                  *      *   *                 *    * *  *

A0A8C0G393_BCL2A1-      aagacacgct-gcatcctttctgcaaaaggaaaatgaagaaagtctgaaa
A0A8C0GRW6_MCL1-01      gcggagggtcggcgacggcgtcattgagaagcaccagatcgccttccaag
A0A8C0G2Q6_BCL2-01      gtgccaagctggagatgaattttcccgtcgctaccacagagattttgccc
A0A8C0IVL6_BCL2L1-      gagagaggcaggagatgagtttgaattgagatatcggagggctttcagtg
                          *    *   *                    *    *     *      

A0A8C0G393_BCL2A1-      ccatgtttggacacacttgatattacctctgtagatgctgccagaagaat
A0A8C0GRW6_MCL1-01      ggatgcttcggaa-gctagacatca-------------agaatgaggatg
A0A8C0G2Q6_BCL2-01      agatgtctggcca-gctgcacttgaccccatt---cacggccagggggcg
A0A8C0IVL6_BCL2L1-      acctcacttccca-actccatatcacccctgg---cacggcataccagag
                           *   *    *  **  *  * *              *          

A0A8C0G393_BCL2A1-      tttcactcaagtcatggata------------aagaatttgctgatggaa
A0A8C0GRW6_MCL1-01      atctga--agtcagtgactgccgttgcaacccatgttttcagtgatggag
A0A8C0G2Q6_BCL2-01      ctttgtggcagtggtggagg------------agctgttccgagatgggg
A0A8C0IVL6_BCL2L1-      ctttgagcaggtagtgaatg------------aactcttccgggacggag
                         *            **                *    **    ** **  

A0A8C0G393_BCL2A1-      acactaactggggacggattttgacaatatttatgtttgg------agga
A0A8C0GRW6_MCL1-01      taacaaactggggtagaattgtgacactcatctcttttggtgcctttgtt
A0A8C0G2Q6_BCL2-01      t---taactggggaaggatcgtggccttctttgaatttgg------tggt
A0A8C0IVL6_BCL2L1-      t---gaactgggggcgcattgtggcttttttctcctttgg------agga
                             ********  * **  ** *  *  *    *****       *  

A0A8C0G393_BCL2A1-      attatttctaagaagcttcaagaacacagagttcagcttacaggaga---
A0A8C0GRW6_MCL1-01      gcaaaac-------acctgaagagcataaa---------ccaggaga---
A0A8C0G2Q6_BCL2-01      gtgatgt-------gcgtggagagcgttaa---------tcgggagatgt
A0A8C0IVL6_BCL2L1-      gccctgt-------gtgtggagagtgtcga---------caaggagatgc
                                         *  ***      *            *****   

A0A8C0G393_BCL2A1-      ------aaataaaaagcagatttcttatttcat----------cacggag
A0A8C0GRW6_MCL1-01      ------------attgca------tcaacacactagcagggatcatcaca
A0A8C0G2Q6_BCL2-01      cgcctcttgtggacagca------ttgctgtgt------ggatgaccgaa
A0A8C0IVL6_BCL2L1-      aggtgttggttggacgca------tcgtctcgt------ggatgaccact
                                       ***      *                   *     

A0A8C0G393_BCL2A1-      tacatt------ataaacaccaaggctgagtggatagaggcaaatggagg
A0A8C0GRW6_MCL1-01      gatgtgcttgtcacaggcaaacgagat---tggctagttaaccaaagagg
A0A8C0G2Q6_BCL2-01      tacctg------aacagacacctacacaactggatccaggacaacggagg
A0A8C0IVL6_BCL2L1-      tacctg------actgaccacctagatccctggatccaagagaatggcgg
                         *  *       *                 *** *        *  * **

A0A8C0G393_BCL2A1-      ttgggaaaatggcttcct--aactatgtttgaggaaaaacg---------
A0A8C0GRW6_MCL1-01      ctggg---agggatttgttgaattcttccgtgtagaggatctagaaggta
A0A8C0G2Q6_BCL2-01      ctggg---atgcctttgtggaattat---acggcaggaaca-tgaggcct
A0A8C0IVL6_BCL2L1-      ttggg---agcggtttgtggatctct---atgggaatgacgctgctgcca
                         ****   *    **  *  *  * *            *           

A0A8C0G393_BCL2A1-      --atcatggctgtccttattcaatattaa----agcaaaaatcatggatg
A0A8C0GRW6_MCL1-01      gcatcaggaatgttctgg--------------tggcttttg-cagg----
A0A8C0G2Q6_BCL2-01      gtgtttgatttctcctggatctctttgaagactatcctaagtctgg----
A0A8C0IVL6_BCL2L1-      agagcaggaaaggccaggagcagttcaacaggtggcttctgaccggggcg
                                      *                    *      *  *    

A0A8C0G393_BCL2A1-      ctttt--------------tccttcttcagtcagtactat----------
A0A8C0GRW6_MCL1-01      -ctttgctgga-------------ctgggagcaagcttagcctacatgat
A0A8C0G2Q6_BCL2-01      -ctctggtgggagcatgcatcaccctgggcgcttatctgggacataag--
A0A8C0IVL6_BCL2L1-      actctggcaggagtgc---tcctgctgggctctctgctgagccgcaag--
                          * *                   **     *     *            

A0A8C0G393_BCL2A1-      ----tga
A0A8C0GRW6_MCL1-01      gcgatga
A0A8C0G2Q6_BCL2-01      ----tga
A0A8C0IVL6_BCL2L1-      ----taa
                            * *

© 1998-2023Legal notice