Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8HYS5_MCL1-01        atgtttgg------------------------------------------
F1PAP1_MCL1-01        atgttcgg------------------------------------------
F1PAP1_MCL1-02        atgttcgg------------------------------------------
Q76LT7_BCL2L1-01      atgtctca------------------------------------------
E2RS00_BCL2A1-02      atgtcccatc----------------------------------------
E2RS00_BCL2A1-01      atgacccagccgggaaccaggttctggagagggagcgaacattccatcag
Q6R755_BCL2-01        atggcgca------------------------------------------
E2QWA1_BCL2-01        ccctttca------------------------------------------
E2QWA1_BCL2-02        atggcgca------------------------------------------
Q75SV7_BCL2-01        atggcgca------------------------------------------
                                                                        

Q8HYS5_MCL1-01        --------------------------------------------------
F1PAP1_MCL1-01        --------------------------------------------------
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
E2RS00_BCL2A1-02      --------------------------------------------------
E2RS00_BCL2A1-01      ggcagattccgcaaaggctaaagtcccatatgtcatcagtgtgcccgggt
Q6R755_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
                                                                        

Q8HYS5_MCL1-01        -------------------------------------------------c
F1PAP1_MCL1-01        -------------------------------------------------c
F1PAP1_MCL1-02        -------------------------------------------------c
Q76LT7_BCL2L1-01      --------------------------------------------------
E2RS00_BCL2A1-02      -------------------------------------------------t
E2RS00_BCL2A1-01      gggaggccaggctccgtgacccagagggctccaccaggcccccgcccggc
Q6R755_BCL2-01        -------------------------------------------------a
E2QWA1_BCL2-01        -------------------------------------------------g
E2QWA1_BCL2-02        -------------------------------------------------c
Q75SV7_BCL2-01        -------------------------------------------------c
                                                                        

Q8HYS5_MCL1-01        ctcaagagaaacgcagtaa---tccggactcaa-ctctactgtggggggg
F1PAP1_MCL1-01        ctcaagagaaacgcagtaa---t-cggactcaacctctactgtggggggg
F1PAP1_MCL1-02        ctcaagagaaacgcagtaa---t-cggactcaacctctactgtggggggg
Q76LT7_BCL2L1-01      ---gagcaa-----------------------------cc----gggagc
E2RS00_BCL2A1-02      ctttggtggttctta-------tgatgcccaacgatgttc--tggggaga
E2RS00_BCL2A1-01      cctcagggactcccaggcacgctaatgacaaatg-tgtccattgggaagg
Q6R755_BCL2-01        gccgggaga---acagggt------------atgataacc----gggaga
E2QWA1_BCL2-01        tttgggggatgcccagtgt------------cct-tttcc----ggg---
E2QWA1_BCL2-02        gctgggcga---acagggt------------acgataacc----gggaga
Q75SV7_BCL2-01        gctgggcga---acagggt------------acgataacc----gggaga
                           *                                 *    **    

Q8HYS5_MCL1-01        ccgggctgg-----------------------------------------
F1PAP1_MCL1-01        ccgggctgg-----------------------------------------
F1PAP1_MCL1-02        ccgggctgg-----------------------------------------
Q76LT7_BCL2L1-01      tggtggttg-----------------------------------------
E2RS00_BCL2A1-02      gaagg---------------------------ctgcctg-----------
E2RS00_BCL2A1-01      agaggaagaaagactggcgtttctccctctttctgcctggtcggctggct
Q6R755_BCL2-01        tcgtgatga-----------------------------------------
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        tagtgatga-----------------------------------------
Q75SV7_BCL2-01        tagtgatga-----------------------------------------
                                                                        

Q8HYS5_MCL1-01        --------------------gggccggcagcggcggcgcctcctcttcgg
F1PAP1_MCL1-01        --------------------gggccggcagcggcggcgcctcctcttcgg
F1PAP1_MCL1-02        --------------------gggccggcagcggcggcgcctcctcttcgg
Q76LT7_BCL2L1-01      ----------------------------------actttctctcctacaa
E2RS00_BCL2A1-02      ------------------------------------------------ct
E2RS00_BCL2A1-01      gaccctgaaggtacagctgggtgggggtggcaacagaacccccaggacct
Q6R755_BCL2-01        ----------------------------------agtacatacattataa
E2QWA1_BCL2-01        -----------------------------------------ccagaactt
E2QWA1_BCL2-02        ----------------------------------agtacatccactacaa
Q75SV7_BCL2-01        ----------------------------------agtacatccactacaa
                                                                        

Q8HYS5_MCL1-01        gagggcggcttttggcttcggggagggaggccacgaccagacgggaggga
F1PAP1_MCL1-01        gagggcggcttttggcttcggggaaggaggccacgaccagacgggaggga
F1PAP1_MCL1-02        gagggcggctttt-------------------------------------
Q76LT7_BCL2L1-01      g-------------------------------------------------
E2RS00_BCL2A1-02      g-------------------------------------------------
E2RS00_BCL2A1-01      g-------------------------------------------------
Q6R755_BCL2-01        g-------------------------------------------------
E2QWA1_BCL2-01        g-------------------------------------------------
E2QWA1_BCL2-02        g-------------------------------------------------
Q75SV7_BCL2-01        g-------------------------------------------------
                      *                                                 

Q8HYS5_MCL1-01        gggggaggggaagccggtgcggtgattggcggaagcgccggcgcaagtcc
F1PAP1_MCL1-01        gggggaggggaagccggtgcggtgattggcggaagcgccggcgcaagtcc
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      -------------------------ctttcccagaaa-------------
E2RS00_BCL2A1-02      -------------------------ttggctt------------------
E2RS00_BCL2A1-01      -------------------------ccagctcaaaggttcaggaaagtca
Q6R755_BCL2-01        -------------------------ctgtcacagagg-------------
E2QWA1_BCL2-01        -------------------------cttcccc------------------
E2QWA1_BCL2-02        -------------------------ctgtcgcagagg-------------
Q75SV7_BCL2-01        -------------------------ctgtcgcagagg-------------
                                                                        

Q8HYS5_MCL1-01        cccgaccactctggcgccggacgcccggagggtcgcgcggccctcaccca
F1PAP1_MCL1-01        cccgaccactctggcgccggacgcccggagggtcgcgcggccctcaccca
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
E2RS00_BCL2A1-02      -----------------------------------catgttcct------
E2RS00_BCL2A1-01      acacacagattttccagaggaggagcaaagtagaacagggtcctcggctg
Q6R755_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
                                                                        

Q8HYS5_MCL1-01        ttggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctg
F1PAP1_MCL1-01        ttggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctg
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
E2RS00_BCL2A1-02      --------------------------------------------------
E2RS00_BCL2A1-01      ccagacttcagacccggggtgactgggcagccaacacgccggaggtctgc
Q6R755_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
                                                                        

Q8HYS5_MCL1-01        ctcgcgcccccctgccgcgc----------------------gtcgccgc
F1PAP1_MCL1-01        ctcgcgcccccctgccgcgc----------------------gtcgccgc
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      ------------------------------------------ggatacag
E2RS00_BCL2A1-02      -----------gtg----------------------------gcccacgc
E2RS00_BCL2A1-01      ctggaagcccagtgctgggccatgggaatctggcaggagcaagcccacgc
Q6R755_BCL2-01        ------------------------------------------ggcta---
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        ------------------------------------------ggcta---
Q75SV7_BCL2-01        ------------------------------------------ggcta---
                                                                        

Q8HYS5_MCL1-01        ctgaag--agatggaaggcccggccgccgacgccatcatgtcgcccgaag
F1PAP1_MCL1-01        ctgaag--agatggaaggcccggccgccgacgccatcatgtcgcccgaag
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      ctggagtcagtttagtgatgtggaagagaacagaactgaggccccagaag
E2RS00_BCL2A1-02      ccg-----agagtgacgaggaggaaggagccggcccagtggtgcacacag
E2RS00_BCL2A1-01      ccg-----agagtgacgaggaggaaggagccggcccagtggtgcacacag
Q6R755_BCL2-01        -cg-----agtgggatgtgggagatgtggacgccgc------gcccctgg
E2QWA1_BCL2-01        ------------------------------cccccc------ccccccag
E2QWA1_BCL2-02        -cg-----agtgggacgcgggagaggcgggcgccgc------gcccccgg
Q75SV7_BCL2-01        -cg-----agtgggacgcgggagaggcgggcgccgc------gcccccgg
                                                                        

Q8HYS5_MCL1-01        aggagctagacgggtacgagccggaacctttggggaagcggccggcggtc
F1PAP1_MCL1-01        aggagctagacgggtacgagccggaacctttggggaagcggccggcggtc
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      ggactgaat-----------------------------------------
E2RS00_BCL2A1-02      aaattccac-----------------------------------------
E2RS00_BCL2A1-01      aaattccac-----------------------------------------
Q6R755_BCL2-01        gc------g-----------------------------------------
E2QWA1_BCL2-01        ggccacctg-----------------------------------------
E2QWA1_BCL2-02        gg------g-----------------------------------------
Q75SV7_BCL2-01        gg------g-----------------------------------------
                                                                        

Q8HYS5_MCL1-01        ctgcctctgctggagctggtgggggaggccagcagtggccccggcatgga
F1PAP1_MCL1-01        ctgcctctgctggagttggtgggggaggccagcagtggccccggcatgga
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      caga----------------gatggagacccccagtgccatcaatggcaa
E2RS00_BCL2A1-02      cagcttccacgtgccgccctgagtcacatcccgagccccgccagccccgg
E2RS00_BCL2A1-01      cagcttccacgtgccgccctgagtcacatcccgagccccgccagccccgg
Q6R755_BCL2-01        ccgcccccac------ccctg--gcatcttc----tccttccagcctgag
E2QWA1_BCL2-01        ccgccgccgc------cgccgccgcctttcc----ccctcgt--------
E2QWA1_BCL2-02        ccgcccccg-------cgccg-ggcatctcc----gcctcgcagnnnnnn
Q75SV7_BCL2-01        ccgcccccg-------cgccg-ggcatcttc----tcctcgcagcccggc
                                                                        

Q8HYS5_MCL1-01        cggctcgctaccctcgacgccacccccggcggaggaggaggaagatgagt
F1PAP1_MCL1-01        cggctcgctaccctcgacgccacccccggcggaggaggaggaagatgagt
F1PAP1_MCL1-02        --------------------------------------------------
Q76LT7_BCL2L1-01      cccatcctggcacttggcag------------------------------
E2RS00_BCL2A1-02      cctcacagggcctcaggcagctcacgggg---------------------
E2RS00_BCL2A1-01      cctcacagggcctcaggcagctcacgggg---------------------
Q6R755_BCL2-01        agcaacccaacgcccg---------ctgt---------------------
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        nnnnnnn------------------nnnn---------------------
Q75SV7_BCL2-01        cgcgcccccgcgcccgccaggacctcgcc---------------------
                                                                        

Q8HYS5_MCL1-01        tgtaccggcagtccctggagattatctctcggtaccttcgggaacaggcc
F1PAP1_MCL1-01        tgtaccggcagtccctggagattatctctcggtaccttcgggaacaggcc
F1PAP1_MCL1-02        ----------------------------------------------ggcc
Q76LT7_BCL2L1-01      --------------------acagccctgcggtgaatggagccactggcc
E2RS00_BCL2A1-02      ----------gaccaggctcccatcccggcgggcgggcgggccaaggatg
E2RS00_BCL2A1-01      ----------gaccaggctcccatcccggcgggcgggcgggccaaggatg
Q6R755_BCL2-01        ----------gcaccgggacatggctgccaggacatcgccactaaggccc
E2QWA1_BCL2-01        --------------------------------------------------
E2QWA1_BCL2-02        ----------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Q75SV7_BCL2-01        ----------gcccccgccccccgccgcccccgctgccgccgccgccgcc
                                                                        

Q8HYS5_MCL1-01        acagg--cgccaaggacgcgaaaccact-gggcgggtctcgggcggccag
F1PAP1_MCL1-01        acagg--cgccaaggacgcgaaaccact-gggcgggtctcgggcggccag
F1PAP1_MCL1-02        acagg--cgccaaggacgcgaaaccact-gggcgggtctcgggcggccag
Q76LT7_BCL2L1-01      acagcagcagcttggatgcccgggaggt-----gatccccatggcagcgg
E2RS00_BCL2A1-02      acgga--ctgcgagtttggctacacgctggcgctggcccaggactacgtg
E2RS00_BCL2A1-01      acgga--ctgcgagtttggctacacgctggcgctggcccaggactacgtg
Q6R755_BCL2-01        atagt--cgccaccactgggcctaccct-----tagccccgtgccacctg
E2QWA1_BCL2-01        -----------------gctcctnnnnn-----cagccccgtgccacctg
E2QWA1_BCL2-02        nnnnn--nnnnnnnnnnnnnnnnnnnnn-----cagccccgtgccacctg
Q75SV7_BCL2-01        gccgc--cgacgccgcgggccccgcgcc-----cagccccgtgccacctg
                                                           *           *

Q8HYS5_MCL1-01        ccggaaggcgttagagaccctcca--gcgagtcggggacggggtacagcg
F1PAP1_MCL1-01        ccggaaggcgttagagaccctccg--gcgagtcggggacggggtacagcg
F1PAP1_MCL1-02        ccggaaggcgttagagaccctccg--gcgagtcggggacggggtacagcg
Q76LT7_BCL2L1-01      -tg-------aaacaagcgctgag--ggaggctggggatgagtttgaact
E2RS00_BCL2A1-02      -aggcacgtcctgcagatcccgcagcccggcccggc--------ccccag
E2RS00_BCL2A1-01      -aggcacgtcctgcagatcccgcagcccggcccggc--------ccccag
Q6R755_BCL2-01        -tg----gtccacctgaccctccg--ccgggctggggatgacttctcccg
E2QWA1_BCL2-01        -tg----gtccacctgaccctgcg--ccaggccggcgacgacttctcccg
E2QWA1_BCL2-02        -tg----gtccacctgaccctgcg--ccaggccggcgacgacttctcccg
Q75SV7_BCL2-01        -tg----gtccacctgaccctgcg--ccaggccggcgacgacttctcccg
                        *                *             **               

Q8HYS5_MCL1-01        caaccacgagacagccttccaaggcatg-----------------cttc-
F1PAP1_MCL1-01        caaccacgagacagccttccaaggcatg-----------------cttc-
F1PAP1_MCL1-02        caaccacgagacagccttccaaggcatg-----------------cttc-
Q76LT7_BCL2L1-01      gaggtaccggcgggcattcagtgacctg--------acatcccagcttc-
E2RS00_BCL2A1-02      cag--agcgtccagggtgctccaggacgtggccttctccgtccaggggca
E2RS00_BCL2A1-01      cag--agcgtccagggtgctccaggacgtggccttctccgtccaggggca
Q6R755_BCL2-01        tcgctaccgtcgcgacttcgcggagatg--------tccagtcagctgc-
E2QWA1_BCL2-01        ccgctaccggcg---tttcgccgagatg--------tccagccagctgc-
E2QWA1_BCL2-02        ccgctaccggcg---tttcgccgagatg--------tccagccagctgc-
Q75SV7_BCL2-01        ccgctaccgccgcgacttcgccgagatg--------tccagccagctgc-
                           *          * *        *                    * 

Q8HYS5_MCL1-01        -------ggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtc
F1PAP1_MCL1-01        -------ggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtc
F1PAP1_MCL1-02        -------ggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtc
Q76LT7_BCL2L1-01      -----------acatcaccccagggaca--g-------catatcagagct
E2RS00_BCL2A1-02      ggtggaaaagaacctgaagccgtgcttg--gacagttttgacgtggtgtc
E2RS00_BCL2A1-01      ggtggaaaagaacctgaagccgtgcttg--gacagttttgacgtggtgtc
Q6R755_BCL2-01        -----------acctgacgcccttcacc--g-------cgaggggacgct
E2QWA1_BCL2-01        -----------acctgacgcccttcacc--g-------cgaggggacgct
E2QWA1_BCL2-02        -----------acctgacgcccttcacc--g-------cgaggggacgct
Q75SV7_BCL2-01        -----------acctgacgcccttcacc--g-------cgaggggacgct
                                 **   *   *         *                *  

Q8HYS5_MCL1-01        tcg---------------------------agtgattgtccatgttttca
F1PAP1_MCL1-01        tcg---------------------------agtgattgtccatgttttca
F1PAP1_MCL1-02        tcg---------------------------agtgattgtccatgttttca
Q76LT7_BCL2L1-01      ttg-----------------------agcaggtagtgaatgaactcttcc
E2RS00_BCL2A1-02      tgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttg
E2RS00_BCL2A1-01      tgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttg
Q6R755_BCL2-01        ttgccac-----------------------ggtggtggaggagctcttca
E2QWA1_BCL2-01        ttgccac-----------------------ggtggtggaggagctcttca
E2QWA1_BCL2-02        ttgccac-----------------------ggtggtggaggagctcttca
Q75SV7_BCL2-01        ttgccac-----------------------ggtggtggaggagctcttca
                      *                              **  *     *    **  

Q8HYS5_MCL1-01        gtgacggagtaacaaactggggcaggattgtgactcttatttcctttggt
F1PAP1_MCL1-01        gtgacggagtaacaaactggggcaggattgtgactcttatttcctttggt
F1PAP1_MCL1-02        gtgacggagtaacaaactggggcaggattgtgactcttatttcctttggt
Q76LT7_BCL2L1-01      gggatgggg---tgaactggggtcgcattgtggcctttttctccttcgg-
E2RS00_BCL2A1-02      aagacggcgtcattaactggggaaggatcgtgaccgtttttgcctttga-
E2RS00_BCL2A1-01      aagacggcgtcattaactggggaaggatcgtgaccgtttttgcctttga-
Q6R755_BCL2-01        gggatgggg---tgaactgggggaggatcgtggccttctttgagttcgg-
E2QWA1_BCL2-01        gggatgggg---tgaactgggggaggatcgtggccttctttgagttcgg-
E2QWA1_BCL2-02        gggatgggg---tgaactgggggaggatcgtggccttctttgagttcgg-
Q75SV7_BCL2-01        gggatgggg---tgaactgggggaggattgtggccttctttgagttcgg-
                        ** ** *     ********  * ** *** *  *  *    ** *  

Q8HYS5_MCL1-01        gcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcga
F1PAP1_MCL1-01        gcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcga
F1PAP1_MCL1-02        gcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcga
Q76LT7_BCL2L1-01      -----tggggcactgtgcgtggagagcgtagacaaggag------atgca
E2RS00_BCL2A1-02      -----aggaattctcaccaagaaactcctcgagcagcga------atttc
E2RS00_BCL2A1-01      -----aggaattctcaccaagaaactcctcgagcagcga------atttc
Q6R755_BCL2-01        -----tggggtcatgtgtgtggagagcgtcaaccgggag------atgtc
E2QWA1_BCL2-01        -----tggggtcatgtgtgtggagagcgtcaaccgggag------atgtc
E2QWA1_BCL2-02        -----tggggtcatgtgtgtggagagcgtcaaccgggag------atgtc
Q75SV7_BCL2-01        -----tggggtcatgtgtgtggagagcgtcaaccgggag------atgtc
                            *             * *     *  *             **   

Q8HYS5_MCL1-01        accattagcagaa------agcatc------------acagatgttctcg
F1PAP1_MCL1-01        accattagcagaa------agcatc------------acagatgttctcg
F1PAP1_MCL1-02        accattagcagaa------agcatc------------acagatgttctcg
Q76LT7_BCL2L1-01      ggtattggtgagt------cggatcgcagcttggatggccacttacctga
E2RS00_BCL2A1-02      ctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatca
E2RS00_BCL2A1-01      ctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatca
Q6R755_BCL2-01        gcccctggtggac------aacatcgccctgtggatgactgagtacctga
E2QWA1_BCL2-01        gcccctggtggac------aacatcgccctgtggatgactgagtacctga
E2QWA1_BCL2-02        gcccctggtggac------aacatcgccctgtggatgactgagtacctga
Q75SV7_BCL2-01        gcccctggtggac------aacatcgccctgtggatgactgagtacctga
                             *               *              *        *  

Q8HYS5_MCL1-01        taaggacgaaacgagactggctagtcaaacaaagaggctggg---atggg
F1PAP1_MCL1-01        taaggacgaaacgagactggctagtcaaacaaagaggctggg---atggg
F1PAP1_MCL1-02        taaggacgaaacgagactggctagtcaaacaaagaggctggg---atggg
Q76LT7_BCL2L1-01      atgaccacctagagccttggatccaggagaacggcggctggg---atact
E2RS00_BCL2A1-02      cgagaaacatgagagactggataagacaaaacggaggctgggaaaacggc
E2RS00_BCL2A1-01      cgagaaacatgagagactggataagacaaaacggaggctgggaaaacggc
Q6R755_BCL2-01        accggcatctgcacacctggatccaggacaacggaggctggg---atgcc
E2QWA1_BCL2-01        accggcatctgcacacctggatccaggacaacggaggctggg---atgcc
E2QWA1_BCL2-02        accggcatctgcacacctggatccaggacaacggaggctggg---atgcc
Q75SV7_BCL2-01        accggcatctgcacacctggatccaggacaacggaggctggg---atgcc
                                       *** *     *  *  * *******   *    

Q8HYS5_MCL1-01        tttgtggagttcttccatgtagaggacctagaaggcggc--------atc
F1PAP1_MCL1-01        tttgtggagttcttccatgtagaggacctagaaggtggc--------atc
F1PAP1_MCL1-02        tttgtggagttcttccatgtagaggacctagaaggtggc--------atc
Q76LT7_BCL2L1-01      tttgtggaactctac--------gggaaca--atgcagcagccgagagcc
E2RS00_BCL2A1-02      tttgtgaagaagttc--------gaaccca------agt--ctggatggc
E2RS00_BCL2A1-01      tttgtgaagaagttc--------gaaccca------agt--ctggatggc
Q6R755_BCL2-01        tttgtggaactgtac--------ggccccaccatgcagc--ct--ctgtt
E2QWA1_BCL2-01        tttgtggaactgtac--------ggccccaccatgcagc--ct--ctgtt
E2QWA1_BCL2-02        tttgtggaactgtac--------ggccccaccatgcagc--ct--ctgtt
Q75SV7_BCL2-01        tttgtggaactgtac--------ggccccaccatgcagc--ct--ctgtt
                      ****** *    * *        *     *       *            

Q8HYS5_MCL1-01        agaaatgtgctgctggcttttgcaggtgttgctgga--------------
F1PAP1_MCL1-01        agaaatgtgctgctggcttttgcaggtgttgctgga--------------
F1PAP1_MCL1-02        agaaatgtgctgctggcttttgcaggtgttgctgga--------------
Q76LT7_BCL2L1-01      ggaagggccaggagcgcttcaaccgctggttcctga----------cagg
E2RS00_BCL2A1-02      tga-------------cttttctggaagttctgggaa---------cagt
E2RS00_BCL2A1-01      tga-------------cttttctggaagttctgggaa---------cagt
Q6R755_BCL2-01        tga-------------tttctcctggctgtctctgaaggcgctgctcagt
E2QWA1_BCL2-01        tga-------------cttctcctggctgtctctgaaggcgctgctcagt
E2QWA1_BCL2-02        tga-------------cttctcctggctgtctctgaaggcgctgctcagt
Q75SV7_BCL2-01        tga-------------cttctcctggctgtctctgaaggcgctgctcagt
                       **              **     *    *    **              

Q8HYS5_MCL1-01        ---------gtaggagctggtttg---------gcatatct---------
F1PAP1_MCL1-01        ---------gtaggagctggtttg---------gcatatct---------
F1PAP1_MCL1-02        ---------gtaggagctggtttg---------gcatatct---------
Q76LT7_BCL2L1-01      catgact--gtggctggcgtggttctgctgggctcgctcttcagtcgga-
E2RS00_BCL2A1-02      ---------gtgtgaaatgtggtcac-------accta---aagcaatac
E2RS00_BCL2A1-01      ---------gtgtgaaatgtggtcac-------accta---aagcaatac
Q6R755_BCL2-01        ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccata-
E2QWA1_BCL2-01        ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccata-
E2QWA1_BCL2-02        ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccata-
Q75SV7_BCL2-01        ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccata-
                               **           *           *               

Q8HYS5_MCL1-01        -aataagatag
F1PAP1_MCL1-01        -aataagatag
F1PAP1_MCL1-02        -aataagatag
Q76LT7_BCL2L1-01      -aatga-----
E2RS00_BCL2A1-02      tactga-----
E2RS00_BCL2A1-01      tactga-----
Q6R755_BCL2-01        -agtga-----
E2QWA1_BCL2-01        -agtga-----
E2QWA1_BCL2-02        -agtga-----
Q75SV7_BCL2-01        -agtga-----
                       * * *     

© 1998-2020Legal notice