Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6R755_BCL2-01          atg-gcgcaagccgggagaacaggg-----tatgataaccgggagatcgt
A0A8C0RVL3_BCL2-01      atg-gcgcacgctgggcgaacaggg-----tacgataaccgggagatagt
Q75SV7_BCL2-01          atg-gcgcacgctgggcgaacaggg-----tacgataaccgggagatagt
A0A8C0Q365_BCL2A1-      atgt---gtccat-----------------tggg----------------
A0A8C0Q365_BCL2A1-      atgtcccatctct-----------------ttggtggttcttatgatgcc
Q8HYS5_MCL1-01          atgtttggcctcaagagaaacgcagtaatccggactcaa----ctctact
A0A8C0S8A7_MCL1-01      atgttcggcctcaagagaaacgcagtaat-cggactcaac---ctctact
A0A8C0S8A7_MCL1-02      atgttcggcctcaagagaaacgcagtaat-cggactcaac---ctctact
Q45T69_BCL2L2-02        atg-gcggcggcggcggcggcgg-------cagcagcagcgggggct---
Q45T69_BCL2L2-01        atg-gcgaccccagcctcagccc-------cagacaca-cgggctctagt
Q45T69_BCL2L2-03        atg-gcgaccccagcctcagccc-------cagacaca-cgggctctagt
                        ***                                               

Q6R755_BCL2-01          gatgaagtacatacattataagctgt-cacagaggggctacgagtggg--
A0A8C0RVL3_BCL2-01      gatgaagtacatccactacaagctgt-cgcagaggggctacgagtggg--
Q75SV7_BCL2-01          gatgaagtacatccactacaagctgt-cgcagaggggctacgagtggg--
A0A8C0Q365_BCL2A1-      -aagga------gag--gaagaaagactggcgtttctccctctttctg--
A0A8C0Q365_BCL2A1-      caacgatgttctggg--gagagaaggctg---------------cctg--
Q8HYS5_MCL1-01          -gtgggggggccgggctgggggccggcagcggcggcgcctcctcttcg--
A0A8C0S8A7_MCL1-01      -gtgggggggccgggctgggggccggcagcggcggcgcctcctcttcg--
A0A8C0S8A7_MCL1-02      -gtgggggggccgggctgggggccggcagcggcggcgcctcctcttcg--
Q45T69_BCL2L2-02        -gcgggcggtcggggctccgggccgg-ggcggcggcgccat-cttgtgcc
Q45T69_BCL2L2-01        ggcagactttgtaggctataagctga-ggcagaagggttatgtttgtg--
Q45T69_BCL2L2-03        ggcagactttgtaggctataagctga-ggcagaagggttatgtttgtg--
                                                *                      *  

Q6R755_BCL2-01          -atgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctg-
A0A8C0RVL3_BCL2-01      -acgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgg-
Q75SV7_BCL2-01          -acgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgg-
A0A8C0Q365_BCL2A1-      --------cctggtcggctggctgaccctgaagcccacgcccgagagtga
A0A8C0Q365_BCL2A1-      --------ct--gttggcttcatgttcctgtggcccacgcccgagagtga
Q8HYS5_MCL1-01          --------ggagggcggcttttggcttcggggagggaggccacgaccaga
A0A8C0S8A7_MCL1-01      --------ggagggcggcttttggcttcggggaaggaggccacgaccaga
A0A8C0S8A7_MCL1-02      --------ggagggcggctttt----------------------------
Q45T69_BCL2L2-02        cggggccggtggggaggc---------cggggagggggccccgggg----
Q45T69_BCL2L2-01        ----------gagctggc---------cctggagagggcccagcagctga
Q45T69_BCL2L2-03        ----------gagctggc---------cctggagagggcccagcagctga
                                    *  * *                                

Q6R755_BCL2-01          --------------------------------------------------
A0A8C0RVL3_BCL2-01      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0Q365_BCL2A1-      cgaggaggaaggagccggcccagtggtgcacacagaaatt----------
A0A8C0Q365_BCL2A1-      cgaggaggaaggagccggcccagtggtgcacacagaaatt----------
Q8HYS5_MCL1-01          cgggagggagggggaggggaagccggtgcggtgattggcggaagcgccgg
A0A8C0S8A7_MCL1-01      cgggagggagggggaggggaagccggtgcggtgattggcggaagcgccgg
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        ---ggcgcaggggactacgggaacggcctg----gagtctgaggaactgg
Q45T69_BCL2L2-01        tccactgcaccaagccatgcgggcagctggagatgagtttgagaccc---
Q45T69_BCL2L2-03        tccactgcaccaagccatgcgggcagctggagatgagtttgagaccc---
                                                                          

Q6R755_BCL2-01          ----------gcatcttctcc----ttccagcct----------gagagc
A0A8C0RVL3_BCL2-01      ----------gcatctccgcc----tcgcagccc----------ggccgc
Q75SV7_BCL2-01          ----------gcatcttctcc----tcgcagccc----------ggccgc
A0A8C0Q365_BCL2A1-      ----------ccaccagcttccacgtgccgccct----------gagtca
A0A8C0Q365_BCL2A1-      ----------ccaccagcttccacgtgccgccct----------gagtca
Q8HYS5_MCL1-01          cgcaagtcccccgaccactctggcgccggacgcccggagg----gtcgcg
A0A8C0S8A7_MCL1-01      cgcaagtcccccgaccactctggcgccggacgcccggagg----gtcgcg
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        agcctgaggagctgctgct--------ggagccc----------gagccg
Q45T69_BCL2L2-01        -gcttccggcgcaccttctctgatttggcagcccagctgcatgtgacccc
Q45T69_BCL2L2-03        -gcttccggcgcaccttctctgatttggcagcccagctgcatgtgacccc
                                                                          

Q6R755_BCL2-01          aacccaacgcccgctgt--------gcaccgggacatggctg--cca---
A0A8C0RVL3_BCL2-01      gcccccgcgcccg---------------ccaggacctcgccgccccc---
Q75SV7_BCL2-01          gcccccgcgcccg---------------ccaggacctcgccgccccc---
A0A8C0Q365_BCL2A1-      catcccgagccccgcca--------gccccggcctcacagggcctcaggc
A0A8C0Q365_BCL2A1-      catcccgagccccgcca--------gccccggcctcacagggcctcaggc
Q8HYS5_MCL1-01          cggccctcacccattggcgctgagggccccaacgtcagcgcgacccc---
A0A8C0S8A7_MCL1-01      cggccctcacccattggcgctgagggccccaacgtcagcgcgacccc---
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        gagcccgagcccgaagaggagcc--gccccggcccc------gcgcc---
Q45T69_BCL2L2-01        aggctc-agcccagcaacgcttc--acccaggtctctgacgaactct---
Q45T69_BCL2L2-03        aggctc-agcccagcaacgcttc--acccaggtctctgacgaactct---
                                                                          

Q6R755_BCL2-01          -ggacatcgccactaaggc-----ccatagtcgc---------caccact
A0A8C0RVL3_BCL2-01      -gccccccgccgcccccgccgccgccgccgccgc---------cgccgcg
Q75SV7_BCL2-01          -gccccccgccgcccccgctgccgccgccgccgccgccgccgacgccgcg
A0A8C0Q365_BCL2A1-      agctcacgggggaccaggctc---ccatcccggcgggcgggcgggccaag
A0A8C0Q365_BCL2A1-      agctcacgggggaccaggctc---ccatcccggcgggcgggcgggccaag
Q8HYS5_MCL1-01          --cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctga
A0A8C0S8A7_MCL1-01      --cccgaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctga
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        --cccccgggagctcc-----gggccct----gggc-c-----tggctcg
Q45T69_BCL2L2-01        --tccaagggggccccaactggggccgtcttgtggc-cttctttgtcttt
Q45T69_BCL2L2-03        --tccaagggggccccaactggggccgtcttgtggc-cttctttgtcttt
                                                                          

Q6R755_BCL2-01          gggcctacccttagccccgt---------------------gccacctg-
A0A8C0RVL3_BCL2-01      ggccccgcgcccagccccgt---------------------gccacctg-
Q75SV7_BCL2-01          ggccccgcgcccagccccgt---------------------gccacctg-
A0A8C0Q365_BCL2A1-      gatgacggactgcgagtttg---------------------gctacacgc
A0A8C0Q365_BCL2A1-      gatgacggactgcgagtttg---------------------gctacacgc
Q8HYS5_MCL1-01          agagatggaaggcccg--------gccgccgacgccatcatgtcgcccg-
A0A8C0S8A7_MCL1-01      agagatggaaggcccg--------gccgccgacgccatcatgtcgcccg-
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        ggagc--ccccggcagccaggag-------gaggaggaggagcc------
Q45T69_BCL2L2-01        ggagctgcactgtgtgctgagagtgtcaacaaagagatggagccacttg-
Q45T69_BCL2L2-03        ggagctgcactgtgtgctgagagtgtcaacaaagagatggagccacttg-
                                                                          

Q6R755_BCL2-01          ------tggtcca-------------------------------------
A0A8C0RVL3_BCL2-01      ------tggtcca-------------------------------------
Q75SV7_BCL2-01          ------tggtcca-------------------------------------
A0A8C0Q365_BCL2A1-      tggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagccc
A0A8C0Q365_BCL2A1-      tggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagccc
Q8HYS5_MCL1-01          aagaggagctagacgggtacgagccggaacctttggggaagcggccggcg
A0A8C0S8A7_MCL1-01      aagaggagctagacgggtacgagccggaacctttggggaagcggccggcg
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        -gggactggt-cgagggtg-----------acccggggg-acgg------
Q45T69_BCL2L2-01        tgggacaagtgcaagagtggatggtggcctacctggagacacggctggcc
Q45T69_BCL2L2-03        tgggacaagtgcaagagtggatggtggcctacctggagacacggctggcc
                                                                          

Q6R755_BCL2-01          --cctgaccctccgccgggctggggatgacttctcccgtcgctaccgt--
A0A8C0RVL3_BCL2-01      --cctgaccctgcgccaggccggcgacgacttctcccgccgctaccgc--
Q75SV7_BCL2-01          --cctgaccctgcgccaggccggcgacgacttctcccgccgctaccgc--
A0A8C0Q365_BCL2A1-      ggcccggcccc-cagcagagcgtccagggtgctccaggacgtggcctt--
A0A8C0Q365_BCL2A1-      ggcccggcccc-cagcagagcgtccagggtgctccaggacgtggcctt--
Q8HYS5_MCL1-01          gtcctgcctctgctggagctggtgggggaggcc---agcagtggccccgg
A0A8C0S8A7_MCL1-01      gtcctgcctctgctggagctggtgggggaggcc---agcagtggccccgg
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        ------------cgccattgaggacccggagct---ggaagcgatcaaag
Q45T69_BCL2L2-01        g-actggatccacagcagtgggggctgggagct---ggaagcgatcaaag
Q45T69_BCL2L2-03        g-actggatccacagcagtgggggctgggcg---------gagttcacag
                                                                          

Q6R755_BCL2-01          -----------------------cgcgacttcg-----------------
A0A8C0RVL3_BCL2-01      -----------------------cgcgacttcg-----------------
Q75SV7_BCL2-01          -----------------------cgcgacttcg-----------------
A0A8C0Q365_BCL2A1-      -----------------------ctccgtccaggg---------------
A0A8C0Q365_BCL2A1-      -----------------------ctccgtccaggg---------------
Q8HYS5_MCL1-01          catggacggctcgctaccctcgacgccacccccggcggaggaggaggaag
A0A8C0S8A7_MCL1-01      catggacggctcgctaccctcgacgccacccccggcggaggaggaggaag
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        -----------------------ctcgagtcagggagatggaggaagaag
Q45T69_BCL2L2-01        -----------------------ctcgagtcagggagatggaggaagaag
Q45T69_BCL2L2-03        -----------------------ctctatacgggga--------------
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
A0A8C0RVL3_BCL2-01      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0Q365_BCL2A1-      --------------------------------------------------
A0A8C0Q365_BCL2A1-      --------------------------------------------------
Q8HYS5_MCL1-01          atgagttgtaccggcagtccctggagattatctctcggtaccttcgggaa
A0A8C0S8A7_MCL1-01      atgagttgtaccggcagtccctggagattatctctcggtaccttcgggaa
A0A8C0S8A7_MCL1-02      --------------------------------------------------
Q45T69_BCL2L2-02        ctgagaagt-------------------------------------taaa
Q45T69_BCL2L2-01        ctgagaagt-------------------------------------taaa
Q45T69_BCL2L2-03        -cggggccc-------------------------------------tgga
                                                                          

Q6R755_BCL2-01          -------------cggagatgtccagtcagctgcacctgacgcccttcac
A0A8C0RVL3_BCL2-01      -------------ccgagatgtccagccagctgcacctgacgcccttcac
Q75SV7_BCL2-01          -------------ccgagatgtccagccagctgcacctgacgcccttcac
A0A8C0Q365_BCL2A1-      ------gcaggt-----ggaaaagaacc---------tgaagccgtgctt
A0A8C0Q365_BCL2A1-      ------gcaggt-----ggaaaagaacc---------tgaagccgtgctt
Q8HYS5_MCL1-01          caggccacaggcgccaaggacgcgaaaccactggg--cgggtct-----c
A0A8C0S8A7_MCL1-01      caggccacaggcgccaaggacgcgaaaccactggg--cgggtct-----c
A0A8C0S8A7_MCL1-02      --ggccacaggcgccaaggacgcgaaaccactggg--cgggtct-----c
Q45T69_BCL2L2-02        ggagctacagaa--cgaggtagagaaacagatgaatatgagtccacctcc
Q45T69_BCL2L2-01        ggagctacagaa--cgaggtagagaaacagatgaatatgagtccacctcc
Q45T69_BCL2L2-03        ggaggcgcggcgtctgcgggaggggaac---------tgggcctcagtga
                                         *         *          *   *       

Q6R755_BCL2-01          cgcgaggggacgc-------------------------------------
A0A8C0RVL3_BCL2-01      cgcgaggggacgc-------------------------------------
Q75SV7_BCL2-01          cgcgaggggacgc-------------------------------------
A0A8C0Q365_BCL2A1-      ggacagttttgac-------------------------------------
A0A8C0Q365_BCL2A1-      ggacagttttgac-------------------------------------
Q8HYS5_MCL1-01          gggcg--gccagcc------------------ggaaggcgttagagacc-
A0A8C0S8A7_MCL1-01      gggcg--gccagcc------------------ggaaggcgttagagacc-
A0A8C0S8A7_MCL1-02      gggcg--gccagcc------------------ggaaggcgttagagacc-
Q45T69_BCL2L2-02        aggcaatgctggcccagtgatcatgtccattgaagagaagatggaggctg
Q45T69_BCL2L2-01        aggcaatgctggcccagtgatcatgtccattgaagagaagatggaggctg
Q45T69_BCL2L2-03        ggacagtgctgac-----------------------------gggggccg
                         *          *                                     

Q6R755_BCL2-01          -----------------tttgccacggtgg----tggaggagc-------
A0A8C0RVL3_BCL2-01      -----------------tttgccacggtgg----tggaggagc-------
Q75SV7_BCL2-01          -----------------tttgccacggtgg----tggaggagc-------
A0A8C0Q365_BCL2A1-      --------------------------gtggtgtctgtcgacacggc----
A0A8C0Q365_BCL2A1-      --------------------------gtggtgtctgtcgacacggc----
Q8HYS5_MCL1-01          -------ctccagcga-gtcggggacgggg--tacagcgcaaccac----
A0A8C0S8A7_MCL1-01      -------ctccggcga-gtcggggacgggg--tacagcgcaaccac----
A0A8C0S8A7_MCL1-02      -------ctccggcga-gtcggggacgggg--tacagcgcaaccac----
Q45T69_BCL2L2-02        atgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaa
Q45T69_BCL2L2-01        atgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaa
Q45T69_BCL2L2-03        -------------------tggcactgggggccctggt------------
                                                  * **                    

Q6R755_BCL2-01          --------------------------------------------------
A0A8C0RVL3_BCL2-01      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0Q365_BCL2A1-      ------------------cagaaccatattc-----aatcaggtgatgga
A0A8C0Q365_BCL2A1-      ------------------cagaaccatattc-----aatcaggtgatgga
Q8HYS5_MCL1-01          ------gagacagccttccaaggc-atgcttcgg--aaactggacatcaa
A0A8C0S8A7_MCL1-01      ------gagacagccttccaaggc-atgcttcgg--aaactggacatcaa
A0A8C0S8A7_MCL1-02      ------gagacagccttccaaggc-atgcttcgg--aaactggacatcaa
Q45T69_BCL2L2-02        gagttggaagcacactttcatggctgtggttcagtcaaccgtgttaccat
Q45T69_BCL2L2-01        gagttggaagcacactttcatggctgtggttcagtcaaccgtgttaccat
Q45T69_BCL2L2-03        ------------------------------------caccg---------
                                                                          

Q6R755_BCL2-01          -------------------------------------------------t
A0A8C0RVL3_BCL2-01      -------------------------------------------------t
Q75SV7_BCL2-01          -------------------------------------------------t
A0A8C0Q365_BCL2A1-      gaaggaa-------------------------------------------
A0A8C0Q365_BCL2A1-      gaaggaa-------------------------------------------
Q8HYS5_MCL1-01          aaacgaagacgatgtcaaatcgttgtctcgagtgattgtccat-----gt
A0A8C0S8A7_MCL1-01      aaacgaagacgatgtcaaatcgttgtctcgagtgattgtccat-----gt
A0A8C0S8A7_MCL1-02      aaacgaagacgatgtcaaatcgttgtctcgagtgattgtccat-----gt
Q45T69_BCL2L2-02        actctgtgacaaatttagtggccatcctaaaggttttgcgtatatagagt
Q45T69_BCL2L2-01        actctgtgacaaatttagtggccatcctaaaggttttgcgtatatagagt
Q45T69_BCL2L2-03        ---------------taggggcctt--------ttttgc-----------
                                                                          

Q6R755_BCL2-01          cttcagggatggggtga---actgggggaggatcgtggccttctttgagt
A0A8C0RVL3_BCL2-01      cttcagggatggggtga---actgggggaggatcgtggccttctttgagt
Q75SV7_BCL2-01          cttcagggatggggtga---actgggggaggattgtggccttctttgagt
A0A8C0Q365_BCL2A1-      -tttgaagacggcgtcattaactggggaaggatcgtgaccgtttttgcct
A0A8C0Q365_BCL2A1-      -tttgaagacggcgtcattaactggggaaggatcgtgaccgtttttgcct
Q8HYS5_MCL1-01          tttcagtgacggagtaacaaactggggcaggattgtgactcttatttcct
A0A8C0S8A7_MCL1-01      tttcagtgacggagtaacaaactggggcaggattgtgactcttatttcct
A0A8C0S8A7_MCL1-02      tttcagtgacggagtaacaaactggggcaggattgtgactcttatttcct
Q45T69_BCL2L2-02        tctcagacaaagagtca--------------gtgaggacttccttggcct
Q45T69_BCL2L2-01        tctcagacaaagagtca--------------gtgaggacttccttggcct
Q45T69_BCL2L2-03        -----------gagcaa--------------gtga---------------
                                   * *  *               *                 

Q6R755_BCL2-01          tcggtgg------ggtcatgtg----tgtggagagcgtcaaccgggagat
A0A8C0RVL3_BCL2-01      tcggtgg------ggtcatgtg----tgtggagagcgtcaaccgggagat
Q75SV7_BCL2-01          tcggtgg------ggtcatgtg----tgtggagagcgtcaaccgggagat
A0A8C0Q365_BCL2A1-      ttgaaggaattctcaccaagaaactcctcgagcagcgaatttcctcggat
A0A8C0Q365_BCL2A1-      ttgaaggaattctcaccaagaaactcctcgagcagcgaatttcctcggat
Q8HYS5_MCL1-01          ttggtgcctttgtggccaaaca----cttgaagagtataaacc-----aa
A0A8C0S8A7_MCL1-01      ttggtgcctttgtggccaaaca----cttgaagagtataaacc-----aa
A0A8C0S8A7_MCL1-02      ttggtgcctttgtggccaaaca----cttgaagagtataaacc-----aa
Q45T69_BCL2L2-02        tagatg-------agtcactat----ttagaggaagacaaatc-----aa
Q45T69_BCL2L2-01        tagatg-------agtcactat----ttagaggaagacaaatc-----aa
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          gtcgcccctgg--------------------tggacaacatcgccctgtg
A0A8C0RVL3_BCL2-01      gtcgcccctgg--------------------tggacaacatcgccctgtg
Q75SV7_BCL2-01          gtcgcccctgg--------------------tggacaacatcgccctgtg
A0A8C0Q365_BCL2A1-      gtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaa
A0A8C0Q365_BCL2A1-      gtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaa
Q8HYS5_MCL1-01          g--aaagctgcatcgaac-----cattag--cagaaagcatcaca-----
A0A8C0S8A7_MCL1-01      g--aaagctgcatcgaac-----cattag--cagaaagcatcaca-----
A0A8C0S8A7_MCL1-02      g--aaagctgcatcgaac-----cattag--cagaaagcatcaca-----
Q45T69_BCL2L2-02        ggtgatcccaaaacgaac-----caacagaccaggcatcagcacaacaga
Q45T69_BCL2L2-01        ggtgatcccaaaacgaac-----caacagaccaggcatcagcacaacaga
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
A0A8C0RVL3_BCL2-01      gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
Q75SV7_BCL2-01          gatgactgagtacctgaaccggcatctgcacacctggatccaggacaacg
A0A8C0Q365_BCL2A1-      catgagagactggataagacaaaac---ggaggctggg---------aaa
A0A8C0Q365_BCL2A1-      catgagagactggataagacaaaac---ggaggctggg---------aaa
Q8HYS5_MCL1-01          ---gatgttctcgtaaggacga-aa---cgagactggctagtcaaacaaa
A0A8C0S8A7_MCL1-01      ---gatgttctcgtaaggacga-aa---cgagactggctagtcaaacaaa
A0A8C0S8A7_MCL1-02      ---gatgttctcgtaaggacga-aa---cgagactggctagtcaaacaaa
Q45T69_BCL2L2-02        ccggggtttcccacgagcccgatac---cgtgcccggactaccaactaca
Q45T69_BCL2L2-01        ccggggtttcccacgagcccgatac---cgtgcccggactaccaactaca
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          gaggctgggatgcctttgtggaactgtac--------ggccccaccatgc
A0A8C0RVL3_BCL2-01      gaggctgggatgcctttgtggaactgtac--------ggccccaccatgc
Q75SV7_BCL2-01          gaggctgggatgcctttgtggaactgtac--------ggccccaccatgc
A0A8C0Q365_BCL2A1-      acggc----------------------tttgtgaagaagttcgaa-----
A0A8C0Q365_BCL2A1-      acggc----------------------tttgtgaagaagttcgaa-----
Q8HYS5_MCL1-01          gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggc
A0A8C0S8A7_MCL1-01      gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggt
A0A8C0S8A7_MCL1-02      gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggt
Q45T69_BCL2L2-02        acagc-----------tcccgctctcgattctacagtggttttaacagca
Q45T69_BCL2L2-01        acagc-----------tcccgctctcgattctacagtggttttaacagca
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          agcctctgtttgatttctcctggctgtctctgaaggcgctgctcagtctg
A0A8C0RVL3_BCL2-01      agcctctgtttgacttctcctggctgtctctgaaggcgctgctcagtctg
Q75SV7_BCL2-01          agcctctgtttgacttctcctggctgtctctgaaggcgctgctcagtctg
A0A8C0Q365_BCL2A1-      ---ccc----aagtctggatggctgacttttctggaagttctgggaacag
A0A8C0Q365_BCL2A1-      ---ccc----aagtctggatggctgacttttctggaagttctgggaacag
Q8HYS5_MCL1-01          ggcatc----agaaatgtgctgctggcttttgcaggtgttgctggagtag
A0A8C0S8A7_MCL1-01      ggcatc----agaaatgtgctgctggcttttgcaggtgttgctggagtag
A0A8C0S8A7_MCL1-02      ggcatc----agaaatgtgctgctggcttttgcaggtgttgctggagtag
Q45T69_BCL2L2-02        ggcccc----gg---------ggtcgcgtctacaggggcc----gggcta
Q45T69_BCL2L2-01        ggcccc----gg---------ggtcgcgtctacaggggcc----gggcta
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          gccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtg
A0A8C0RVL3_BCL2-01      gccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtg
Q75SV7_BCL2-01          gccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtg
A0A8C0Q365_BCL2A1-      tgtgtgaaatg---tggtcacacctaaagcaatactactga---------
A0A8C0Q365_BCL2A1-      tgtgtgaaatg---tggtcacacctaaagcaatactactga---------
Q8HYS5_MCL1-01          gagctggtttg---gcatatctaataagatag------------------
A0A8C0S8A7_MCL1-01      gagctggtttg---gcatatctaataagatag------------------
A0A8C0S8A7_MCL1-02      gagctggtttg---gcatatctaataagatag------------------
Q45T69_BCL2L2-02        gagcgacatca---tggtattccccttactaa------------------
Q45T69_BCL2L2-01        gagcgacatca---tggtattccccttactaa------------------
Q45T69_BCL2L2-03        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          a
A0A8C0RVL3_BCL2-01      a
Q75SV7_BCL2-01          a
A0A8C0Q365_BCL2A1-      -
A0A8C0Q365_BCL2A1-      -
Q8HYS5_MCL1-01          -
A0A8C0S8A7_MCL1-01      -
A0A8C0S8A7_MCL1-02      -
Q45T69_BCL2L2-02        -
Q45T69_BCL2L2-01        -
Q45T69_BCL2L2-03        -
                         

© 1998-2022Legal notice