Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6R755_BCL2-01          atggcg------------------------caagccgggagaacagggta
Q75SV7_BCL2-01          atggcg------------------------cacgctgggcgaacagggta
Q8HYS5_MCL1-01          atgtttggcctcaagagaaacgcagtaatccggactcaa-ctctactgtg
A0A5F4BWG4_MCL1-01      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtg
A0A5F4BWG4_MCL1-02      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtg
Q76LT7_BCL2L1-01        at------------------------------------------gtctca
Q45T69_BCL2L2-03        atgg--------------------------cggcggcggcggcggcggca
Q45T69_BCL2L2-01        atgg--------------------------cgaccccagcctcagcccca
Q45T69_BCL2L2-02        atgg--------------------------cgaccccagcctcagcccca
                        **                                                

Q6R755_BCL2-01          tgataaccgggagatcgtgatgaagtacatacattataagctgtcacaga
Q75SV7_BCL2-01          cgataaccgggagatagtgatgaagtacatccactacaagctgtcgcaga
Q8HYS5_MCL1-01          ggggggccggg--ctgggggccggcagcggcggcgcc--tcctcttcggg
A0A5F4BWG4_MCL1-01      ggggggccggg--ctgggggccggcagcggcggcgcc--tcctcttcggg
A0A5F4BWG4_MCL1-02      ggggggccggg--ctgggggccggcagcggcggcgcc--tcctcttcggg
Q76LT7_BCL2L1-01        gagcaaccgggagctggtggttgactttctctcctacaagctttcccaga
Q45T69_BCL2L2-03        gcagcagcgggggct----gcgggcggtcggggctccgggccggggcggc
Q45T69_BCL2L2-01        gacaca-cgggctctagtggcagactttgtaggctataagctgaggcaga
Q45T69_BCL2L2-02        gacaca-cgggctctagtggcagactttgtaggctataagctgaggcaga
                               ****   *                         *     * * 

Q6R755_BCL2-01          ggggctac------------------------------------gagtgg
Q75SV7_BCL2-01          ggggctac------------------------------------gagtgg
Q8HYS5_MCL1-01          agggcggcttttggcttcggggag----ggaggccacgaccagacgggag
A0A5F4BWG4_MCL1-01      agggcggcttttggcttcggggaa----ggaggccacgaccagacgggag
A0A5F4BWG4_MCL1-02      agggcggctttt--------------------------------------
Q76LT7_BCL2L1-01        aaggatacagctggagtcagtttagtgatgtggaagagaacagaactgag
Q45T69_BCL2L2-03        ggcgccat-ct-----------------tgtgcccggggccggtggggag
Q45T69_BCL2L2-01        agggttatgtt-----------------tgtg------------gagctg
Q45T69_BCL2L2-02        agggttatgtt-----------------tgtg------------gagctg
                           *                                              

Q6R755_BCL2-01          gatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctgg
Q75SV7_BCL2-01          gacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccggg
Q8HYS5_MCL1-01          ggagggggaggggaagccggtgcggtgattggcggaagcgccggcgcaag
A0A5F4BWG4_MCL1-01      ggagggggaggggaagccggtgcggtgattggcggaagcgccggcgcaag
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        gccccagaagggactgaatcagagatggagacccccagtgccatcaatgg
Q45T69_BCL2L2-03        gccggggagggg--------------------------------------
Q45T69_BCL2L2-01        gccctggagagg--------------------------------------
Q45T69_BCL2L2-02        gccctggagagg--------------------------------------
                                                                          

Q6R755_BCL2-01          catcttctccttccagcctgagagcaacccaacgcccgctgtgcaccggg
Q75SV7_BCL2-01          catcttctcctcgcagcccggccgcgcccccgcgcccg-------ccagg
Q8HYS5_MCL1-01          tcccccgaccactctggcgccggacgcccggagggtcgcgcggccctcac
A0A5F4BWG4_MCL1-01      tcccccgaccactctggcgccggacgcccggagggtcgcgcggccctcac
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        caacccatcctggcacttggcagacagccctgcggt--------------
Q45T69_BCL2L2-03        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          acatggctg--------ccaggacatcgccactaaggc--------ccat
Q75SV7_BCL2-01          acctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgc
Q8HYS5_MCL1-01          ccattggcgctgaggg-ccccaacgtcagcgcgaccccc-------ccga
A0A5F4BWG4_MCL1-01      ccattggcgctgaggg-ccccaacgtcagcgcgaccccc-------ccga
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        -gaatggagccactgg-ccacagcagcagcttggatgcc-------cggg
Q45T69_BCL2L2-03        ------------------------------------gcc-------ccgg
Q45T69_BCL2L2-01        ------------------------------------gcc-------cagc
Q45T69_BCL2L2-02        ------------------------------------gcc-------cagc
                                                                          

Q6R755_BCL2-01          agtcgccaccactgggcctacccttagccccgtgccacctgtggt-----
Q75SV7_BCL2-01          cgccgacgccgcgggccccgcgcccagccccgtgccacctgtggt-----
Q8HYS5_MCL1-01          ggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaagagatg
A0A5F4BWG4_MCL1-01      ggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaagagatg
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        aggtgatccccatggcagcggt----------------------------
Q45T69_BCL2L2-03        gg-----------------ggc----------------------------
Q45T69_BCL2L2-01        agctgatc----------cact----------------------------
Q45T69_BCL2L2-02        agctgatc----------cact----------------------------
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          gaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgg
A0A5F4BWG4_MCL1-01      gaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgg
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          gtacgagccggaacctttggggaagcggccggcggtcctgcctctgctgg
A0A5F4BWG4_MCL1-01      gtacgagccggaacctttggggaagcggccggcggtcctgcctctgctgg
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          agctggtgggggaggccagcagtggccccggcatggacggctcgctaccc
A0A5F4BWG4_MCL1-01      agttggtgggggaggccagcagtggccccggcatggacggctcgctaccc
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          tcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtc
A0A5F4BWG4_MCL1-01      tcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtc
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        --------------------------------------------------
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        --------------------------------------------------
                                                                          

Q6R755_BCL2-01          ----------------------------------ccacctgaccctccgc
Q75SV7_BCL2-01          ----------------------------------ccacctgaccctgcgc
Q8HYS5_MCL1-01          cctggagattatctctcggtaccttcgggaacaggccacaggcgccaagg
A0A5F4BWG4_MCL1-01      cctggagattatctctcggtaccttcgggaacaggccacaggcgccaagg
A0A5F4BWG4_MCL1-02      ---------------------------------ggccacaggcgccaagg
Q76LT7_BCL2L1-01        ----------------------------------gaaacaagcgctgagg
Q45T69_BCL2L2-03        ----------------------------------gcaggggactacggga
Q45T69_BCL2L2-01        ----------------------------------gcaccaagccatgcgg
Q45T69_BCL2L2-02        ----------------------------------gcaccaagccatgcgg
                                                                  *     * 

Q6R755_BCL2-01          cgg-------gctggggatgacttctc----------ccgtcgctaccgt
Q75SV7_BCL2-01          cag-------gccggcgacgacttctc----------ccgccgctaccgc
Q8HYS5_MCL1-01          acgcgaaaccactgg--gcgggtctcgggcggccagccggaaggcgttag
A0A5F4BWG4_MCL1-01      acgcgaaaccactgg--gcgggtctcgggcggccagccggaaggcgttag
A0A5F4BWG4_MCL1-02      acgcgaaaccactgg--gcgggtctcgggcggccagccggaaggcgttag
Q76LT7_BCL2L1-01        gag-------gctggggatgagtttgaactg------a----ggtaccgg
Q45T69_BCL2L2-03        acg-------gcctg----gagtctgaggaa------ctggagcctgagg
Q45T69_BCL2L2-01        gca-------gctggagatgagtttgagacc------c----gcttccgg
Q45T69_BCL2L2-02        gca-------gctggagatgagtttgagacc------c----gcttccgg
                                   *  *    *  *                   *       

Q6R755_BCL2-01          cgcgacttcgcggagatgtccagtcagctgcacctgacgcccttcac-cg
Q75SV7_BCL2-01          cgcgacttcgccgagatgtccagccagctgcacctgacgcccttcac-cg
Q8HYS5_MCL1-01          agaccctccagcgagtcggggacggggtacagcgcaaccacgagac--ag
A0A5F4BWG4_MCL1-01      agaccctccggcgagtcggggacggggtacagcgcaaccacgagac--ag
A0A5F4BWG4_MCL1-02      agaccctccggcgagtcggggacggggtacagcgcaaccacgagac--ag
Q76LT7_BCL2L1-01        cgggcattcagtgacctgacatcccagcttcacatcaccccagggac-ag
Q45T69_BCL2L2-03        agctgctgct--------ggagccc----------gagccggagcccgag
Q45T69_BCL2L2-01        cgcaccttctctgatttggcagcccagctgcatgtgaccccaggctc-ag
Q45T69_BCL2L2-02        cgcaccttctctgatttggcagcccagctgcatgtgaccccaggctc-ag
                         *    * *                           *            *

Q6R755_BCL2-01          cgaggggacgctttgccacg------------------------------
Q75SV7_BCL2-01          cgaggggacgctttgccacg------------------------------
Q8HYS5_MCL1-01          ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A5F4BWG4_MCL1-01      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A5F4BWG4_MCL1-02      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
Q76LT7_BCL2L1-01        catatcagagctttgagcag------------------------------
Q45T69_BCL2L2-03        cccgaagaggagccgccccg------------------------------
Q45T69_BCL2L2-01        cccagcaacgcttcacccag------------------------------
Q45T69_BCL2L2-02        cccagcaacgcttcacccag------------------------------
                        *        *         *                              

Q6R755_BCL2-01          --------gtggtggagga------gctcttcagg----gatggggtgaa
Q75SV7_BCL2-01          --------gtggtggagga------gctcttcagg----gatggggtgaa
Q8HYS5_MCL1-01          aaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
A0A5F4BWG4_MCL1-01      aaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
A0A5F4BWG4_MCL1-02      aaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
Q76LT7_BCL2L1-01        --------gtagtgaatga------actcttccgg----gatggggtgaa
Q45T69_BCL2L2-03        --------gcccc------------gcgccccccc----gggagctcc--
Q45T69_BCL2L2-01        --------gtctctgacga------actcttccaa----gggggccccaa
Q45T69_BCL2L2-02        --------gtctctgacga------actcttccaa----gggggccccaa
                                *                              *          

Q6R755_BCL2-01          ctgggggaggatcgtggccttctttgagttcggtggggtcatgtg-----
Q75SV7_BCL2-01          ctgggggaggattgtggccttctttgagttcggtggggtcatgtg-----
Q8HYS5_MCL1-01          ctggggcaggattgtgactcttatttcctttggtgc--ctttgtggccaa
A0A5F4BWG4_MCL1-01      ctggggcaggattgtgactcttatttcctttggtgc--ctttgtggccaa
A0A5F4BWG4_MCL1-02      ctggggcaggattgtgactcttatttcctttggtgc--ctttgtggccaa
Q76LT7_BCL2L1-01        ctggggtcgcattgtggcctttttctccttcggtggggcactgtg-----
Q45T69_BCL2L2-03        ---gggccct----gggcc-----tggctcgggagc--ccccggc-----
Q45T69_BCL2L2-01        ctggggccgtcttgtggccttctttgtctttggagctgcactgtg-----
Q45T69_BCL2L2-02        ctggggccgtcttgtggccttctttgtctttggagctgcactgtg-----
                           ***         * *          *  ** *       *       

Q6R755_BCL2-01          ---tgtggagagcgtcaaccgggag------atgtcgcccctggtggaca
Q75SV7_BCL2-01          ---tgtggagagcgtcaaccgggag------atgtcgcccctggtggaca
Q8HYS5_MCL1-01          acacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
A0A5F4BWG4_MCL1-01      acacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
A0A5F4BWG4_MCL1-02      acacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
Q76LT7_BCL2L1-01        ---cgtggagagcgtagacaaggag------atgcaggtattggtgagtc
Q45T69_BCL2L2-03        ---agccaggag-------gaggag------gaggagcc------gggac
Q45T69_BCL2L2-01        ---tgctgagagtgtcaacaaagag------atggagccacttgtgggac
Q45T69_BCL2L2-02        ---tgctgagagtgtcaacaaagag------atggagccacttgtgggac
                                 ***          **                          

Q6R755_BCL2-01          acatcgccctgtggatgactgagtacctgaaccggcatctgcacacctgg
Q75SV7_BCL2-01          acatcgccctgtggatgactgagtacctgaaccggcatctgcacacctgg
Q8HYS5_MCL1-01          gcatcacag-----------atgttctcgtaaggacgaaacga-gactgg
A0A5F4BWG4_MCL1-01      gcatcacag-----------atgttctcgtaaggacgaaacga-gactgg
A0A5F4BWG4_MCL1-02      gcatcacag-----------atgttctcgtaaggacgaaacga-gactgg
Q76LT7_BCL2L1-01        ggatcgcagcttggatggccacttacctgaatgaccacctagagccttgg
Q45T69_BCL2L2-03        tggt-cgagggtg-----------acccggggg-acgg------------
Q45T69_BCL2L2-01        aagtgcaagagtggatggtggcctacctggagacacggctggccgactgg
Q45T69_BCL2L2-02        aagtgcaagagtggatggtggcctacctggagacacggctggccgactgg
                           *                     *  *      *              

Q6R755_BCL2-01          atccaggacaacggaggctgggat------gcctttgtggaactgtacgg
Q75SV7_BCL2-01          atccaggacaacggaggctgggat------gcctttgtggaactgtacgg
Q8HYS5_MCL1-01          ctagtcaaacaaagaggctgggat------gggtttgtggagttcttcca
A0A5F4BWG4_MCL1-01      ctagtcaaacaaagaggctgggat------gggtttgtggagttcttcca
A0A5F4BWG4_MCL1-02      ctagtcaaacaaagaggctgggat------gggtttgtggagttcttcca
Q76LT7_BCL2L1-01        atccaggagaacggcggctgggat------acttttgtggaactctacgg
Q45T69_BCL2L2-03        -----cgccattgaggacccggagctggaagcgatcaaagctcgagtcag
Q45T69_BCL2L2-01        atccacagcagtgggggctgggcg------gagttcacagctctatacgg
Q45T69_BCL2L2-02        atccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcag
                                       * *  **            *    *       *  

Q6R755_BCL2-01          ccccacc-atgcagcctctg------------------------------
Q75SV7_BCL2-01          ccccacc-atgcagcctctg------------------------------
Q8HYS5_MCL1-01          tgtagaggacctagaaggcggcatcagaaatgtgct--------------
A0A5F4BWG4_MCL1-01      tgtagaggacctagaaggtggcatcagaaatgtgct--------------
A0A5F4BWG4_MCL1-02      tgtagaggacctagaaggtggcatcagaaatgtgct--------------
Q76LT7_BCL2L1-01        gaaca---atgcagcagccgagagccggaagggccaggagcg--------
Q45T69_BCL2L2-03        ggagatggaggaagaagctgagaagttaaaggagctacagaa--cgaggt
Q45T69_BCL2L2-01        gga---------------cggggccctggaggaggcgcggcgtctgcggg
Q45T69_BCL2L2-02        ggagatggaggaagaagctgagaagttaaaggagctacagaa--cgaggt
                                           *                              

Q6R755_BCL2-01          ---------------tttgatttctcctg---------------------
Q75SV7_BCL2-01          ---------------tttgacttctcctg---------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A5F4BWG4_MCL1-01      --------------------------------------------------
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------cttcaacc----------------
Q45T69_BCL2L2-03        agagaaacagatgaatatgagtccacctccaggcaatgctggcccagtga
Q45T69_BCL2L2-01        aggggaac---------tgggcctcagtgaggacagtgctgac-------
Q45T69_BCL2L2-02        agagaaacagatgaatatgagtccacctccaggcaatgctggcccagtga
                                                                          

Q6R755_BCL2-01          --------------------------gctgtctct---------------
Q75SV7_BCL2-01          --------------------------gctgtctct---------------
Q8HYS5_MCL1-01          --------------------------gctggctt---------------t
A0A5F4BWG4_MCL1-01      --------------------------gctggctt---------------t
A0A5F4BWG4_MCL1-02      --------------------------gctggctt---------------t
Q76LT7_BCL2L1-01        --------------------------gctggttcc--------------t
Q45T69_BCL2L2-03        tcatgtccattgaagagaagatggaggctgatgcccgttccatttatgtt
Q45T69_BCL2L2-01        ----------------------gggggccg-------------------t
Q45T69_BCL2L2-02        tcatgtccattgaagagaagatggaggctgatgcccgttccatttatgtt
                                                  ** *                    

Q6R755_BCL2-01          -gaaggcgctgctcagtc--------------------------------
Q75SV7_BCL2-01          -gaaggcgctgctcagtc--------------------------------
Q8HYS5_MCL1-01          tgcaggtgttgctggagt--------------------------------
A0A5F4BWG4_MCL1-01      tgcaggtgttgctggagt--------------------------------
A0A5F4BWG4_MCL1-02      tgcaggtgttgctggagt--------------------------------
Q76LT7_BCL2L1-01        gacaggcatgactgtggc--------------------------------
Q45T69_BCL2L2-03        ggcaatgtggactatggtgcaacagcagaagagttggaagcacactttca
Q45T69_BCL2L2-01        ggcactgggggccctggt--------------------------------
Q45T69_BCL2L2-02        ggcaatgtggactatggtgcaacagcagaagagttggaagcacactttca
                           *       *                                      

Q6R755_BCL2-01          ------------------------------------------------tg
Q75SV7_BCL2-01          ------------------------------------------------tg
Q8HYS5_MCL1-01          ----------------------------------------------agga
A0A5F4BWG4_MCL1-01      ----------------------------------------------agga
A0A5F4BWG4_MCL1-02      ----------------------------------------------agga
Q76LT7_BCL2L1-01        ------------------------------------------------tg
Q45T69_BCL2L2-03        tggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtg
Q45T69_BCL2L2-01        ----------------caccg------------------------taggg
Q45T69_BCL2L2-02        tggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtg
                                                                          

Q6R755_BCL2-01          gccctggtgggagcttgcatcaccctgggtgcctatctgg----------
Q75SV7_BCL2-01          gccctggtgggagcttgcatcaccctgggtgcctatctgg----------
Q8HYS5_MCL1-01          gc--------tggttt-------------ggcatatctaa----------
A0A5F4BWG4_MCL1-01      gc--------tggttt-------------ggcatatctaa----------
A0A5F4BWG4_MCL1-02      gc--------tggttt-------------ggcatatctaa----------
Q76LT7_BCL2L1-01        gc-------gtggttc-------------tgc------------------
Q45T69_BCL2L2-03        gccatcctaaaggttt-------------tgcgtatatagagttctcaga
Q45T69_BCL2L2-01        gcctt--------ttt-------------tgc------------------
Q45T69_BCL2L2-02        gccatcctaaaggttt-------------tgcgtatatagagttctcaga
                        **            *               **                  

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A5F4BWG4_MCL1-01      --------------------------------------------------
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        -----------tggg-----------------------------------
Q45T69_BCL2L2-03        caaagagtcagtgaggacttccttggccttagatgagtcactatttagag
Q45T69_BCL2L2-01        ----gagcaagtga------------------------------------
Q45T69_BCL2L2-02        caaagagtcagtgaggacttccttggccttagatgagtcactatttagag
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A5F4BWG4_MCL1-01      --------------------------------------------------
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        gaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagc
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        gaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagc
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A5F4BWG4_MCL1-01      --------------------------------------------------
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        acaacagaccggggtttcccacgagcccgataccgtgcccggactaccaa
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        acaacagaccggggtttcccacgagcccgataccgtgcccggactaccaa
                                                                          

Q6R755_BCL2-01          ----------------------gccataagtga-----------------
Q75SV7_BCL2-01          ----------------------gccataagtga-----------------
Q8HYS5_MCL1-01          -------------------------taagatag-----------------
A0A5F4BWG4_MCL1-01      -------------------------taagatag-----------------
A0A5F4BWG4_MCL1-02      -------------------------taagatag-----------------
Q76LT7_BCL2L1-01        -----------ctcgctcttcagtcggaaatga-----------------
Q45T69_BCL2L2-03        ctacaacagctcccgctctcgattctacagtggttttaacagcaggcccc
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        ctacaacagctcccgctctcgattctacagtggttttaacagcaggcccc
                                                                          

Q6R755_BCL2-01          --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A5F4BWG4_MCL1-01      --------------------------------------------------
A0A5F4BWG4_MCL1-02      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q45T69_BCL2L2-03        ggggtcgcgtctacaggggccgggctagagcgacatcatggtattcccct
Q45T69_BCL2L2-01        --------------------------------------------------
Q45T69_BCL2L2-02        ggggtcgcgtctacaggggccgggctagagcgacatcatggtattcccct
                                                                          

Q6R755_BCL2-01          ------
Q75SV7_BCL2-01          ------
Q8HYS5_MCL1-01          ------
A0A5F4BWG4_MCL1-01      ------
A0A5F4BWG4_MCL1-02      ------
Q76LT7_BCL2L1-01        ------
Q45T69_BCL2L2-03        tactaa
Q45T69_BCL2L2-01        ------
Q45T69_BCL2L2-02        tactaa
                              

© 1998-2022Legal notice