Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C0Q365_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=780 residues).
atgtgtccattgggaaggagaggaagaaagactggcgtttctccctctttctgcctggtcggctggctgaccctgaagcc
cacgcccgagagtgacgaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccctg
agtcacatcccgagccccgccagccccggcctcacagggcctcaggcagctcacgggggaccaggctcccatcccggcgg
gcgggcgggccaaggatgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgca
gatcccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtgg
aaaagaacctgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatg
gagaaggaatttgaagacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaa
actcctcgagcagcgaatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaaca
tgagagactggataagacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgact
tttctggaagttctgggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8C0Q365_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=789 residues).
atgtcccatctctttggtggttcttatgatgcccaacgatgttctggggagagaaggctgcctgctgttggcttcatgtt
cctgtggcccacgcccgagagtgacgaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttccacgt
gccgccctgagtcacatcccgagccccgccagccccggcctcacagggcctcaggcagctcacgggggaccaggctccca
tcccggcgggcgggcgggccaaggatgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggca
cgtcctgcagatcccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccagg
ggcaggtggaaaagaacctgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaat
caggtgatggagaaggaatttgaagacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattct
caccaagaaactcctcgagcagcgaatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatca
cgagaaacatgagagactggataagacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctgga
tggctgacttttctggaagttctgggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8C0RVL3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgccgccgccgccgccgccgccgcgggc
cccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0S8A7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0S8A7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=594 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagcc
ggaaggcgttagagaccctccggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|Q45T69_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|Q45T69_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaaga
gttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccg
tgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|Q45T69_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2022Legal notice