Dataset for CDS BAX-like of Organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A6H6W7_BOK-01       at-------ggaggtgctgcggcgct--cctcggtcttcgccgccgagatcatggacgcc
Q05KI7_BAK1-01      atggcttccggacaaggcccaggtcc--ccccgggcaggactgcgacgagc---------
O02703_BAX-01       at-------ggacgggtccggggagcaacccagag-------gcggggggc---------
O02703_BAX-02       at-------ggacgggtccggggagcaacccagag-------gcggggggc---------
                    **       ***   *     *      **  *         **   *  *         

A6H6W7_BOK-01       tttgaccgctcgcccaccgacaaggagctggtggcccaggcca------aggctctcggc
Q05KI7_BAK1-01      -ctgacccctcctccacctcggaggagcaggtggcccgggacaccgaggaggtcttccgc
O02703_BAX-01       ----------ccaccagctctgagca------gatcatgaagac--aggggcccttttgc
O02703_BAX-02       ----------ccaccagctctgagca------gatcatgaagac--aggggcccttttgc
                              *  *** *    ** *      *  *  *   *       *    *  **

A6H6W7_BOK-01       cgcgagttcgtgcacgcgcgactgctg---cgcgctggcctctcctggagc---------
Q05KI7_BAK1-01      agctacgtcttttaccgccatcagcaggaac-aggaggccgagggggcggctgcgcctac
O02703_BAX-01       ttcagggttt--------catc--caggatcgagcagggcgaatgggggg--------ag
O02703_BAX-02       ttcagggttt--------catc--caggatcgagcagggcgaatgggggg--------ag
                      *    *          *  *  * *   *  *  ** *      *  *          

A6H6W7_BOK-01       --gcgcccgagc---gcgccgcgccggtccccggcggc-------cgcctggcggaggtg
Q05KI7_BAK1-01      tgac-ccagagatggtcaccttgca-----cccagaacctagcagcaccatggggcag-g
O02703_BAX-01       agacacccgagctgggcttggagcaggtgccccaggatgcatc--caccaagaagctgag
O02703_BAX-02       agacacccgagctgggcttggagcaggtgccccaggatgcatc--caccaagaagctgag
                       * ** ***     *     **      **             * **  *  *  * *

A6H6W7_BOK-01       tgcgccgtgctgctgcg----cctggcggacgagctggagctgatccggcccagtgtcta
Q05KI7_BAK1-01      tgggcc--gccagctcgccgtcatcggggacgacatcaa------ccggc---------g
O02703_BAX-01       cgagtg--tctgaagcg----catcggagatgaattgga------cag------------
O02703_BAX-02       cgagtg--tctgaagcg----catcggagatgaattgga------cag------------
                     * *     *     **    * * *  ** **  *  *      * *            

A6H6W7_BOK-01       ccgcaacgtggcccgccagctgaacctctc---cctgcagtcg----gagaccgtggtga
Q05KI7_BAK1-01      ctacgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgccta
O02703_BAX-01       ---taacatggagctgcagaggatgat--cgcagctgtggaca----cagactctccccg
O02703_BAX-02       ---taacatggagctgcagaggatgat--cgcagctgtggaca----cagactctccccg
                         *   **     ***   *   *       ***  * *      ****        

A6H6W7_BOK-01       ccgacgccttcctggctgtggcgacccagatcttttctgcaggca---tcacgtggggca
Q05KI7_BAK1-01      -tgagtacttcaccaagatcgcgtccagcctgtt---tgagagcggtatcaactggggcc
O02703_BAX-01       -agaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactggggcc
O02703_BAX-02       -agaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactggggcc
                      **   ***        * *** *     * **   **   **    ***  ****** 

A6H6W7_BOK-01       aagttgtgtccctgtactccgtggccgcggggctggccgt--ggactgtgtgcggcaggc
Q05KI7_BAK1-01      gcgtggtggctctgctgggctttggctaccgcctggccct-----ccacgtctacca---
O02703_BAX-01       gggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaagg
O02703_BAX-02       gggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaagg
                      ** **  * **      * * * *      ****   *     *   **    **   

A6H6W7_BOK-01       ccagcccgccctggtgcacgccctcgtcgactgtctcggggagtttgtgcggaagacgc-
Q05KI7_BAK1-01      ---gcgcggcctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgact
O02703_BAX-01       t--gcccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggc-
O02703_BAX-02       t--gcccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggc-
                       ** **   **        * ** * * *         **     * **       * 

A6H6W7_BOK-01       ---tggcaacc---------------tggctgcggaggcgtggtggatggacggacgtgc
Q05KI7_BAK1-01      tcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccc
O02703_BAX-01       ---tgctgggc---------------tggatccaggaccagggtggttg-----------
O02703_BAX-02       ---tgctgggc---------------tggatccaggaccagggtggttgggtgagacctc
                       **                     *** *   *      ***** **           

A6H6W7_BOK-01       t-----------------------------------------------------------
Q05KI7_BAK1-01      t------------------------------ggacttggg--------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       taaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccaccatag
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       gagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagggtgc
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       ccaatgacctgtccatgacccttgacctccttgtgacctctgacctcctagtgacccctg
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       acccgatgcctcgatgccctccctggtgcctccctccaattcctctggaatccctcaagt
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       tctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccctctga
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       cccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgctgaagt
                                                                                

A6H6W7_BOK-01       -----------------caagtgcgtggtcagcaccgacccgggcctgcgctcgcactgg
Q05KI7_BAK1-01      --------------------gaacggccccatc------------------------aag
O02703_BAX-01       --------------------ggacggcctcctctcctactttgggacacccacatggcag
O02703_BAX-02       gcctgctgtccctatccccaggacggcctcctctcctactttgggacacccacatggcag
                                        *  **    *  *                          *

A6H6W7_BOK-01       ctggtggccgcgctctgcagctttggccgcttcctgaaggcagccttcttcatgctgttg
Q05KI7_BAK1-01      agcgtagccat-cgttctggctgtgg--------ttttgttgggccagtttgtggt----
O02703_BAX-01       acagtgaccat-ctttgtggctggag--------tgctcaccgcctcgctcaccatctgg
O02703_BAX-02       acagtgaccat-ctttgtggctggag--------tgctcaccgcctcgctcaccatctgg
                       **  **   *  *   ***   *        *       * *    *     *    

A6H6W7_BOK-01       ccggagag----------------------------------------------------
Q05KI7_BAK1-01      acgaagat----------------------------------------------------
O02703_BAX-01       aagaagatgggctga---------------------------------------------
O02703_BAX-02       aagaagatgggctgaggccatcaactgccttggactttttctgcataaattatggcattt
                      * ***                                                     

A6H6W7_BOK-01       -------------------------------------------------atga
Q05KI7_BAK1-01      ---------------------------------------tcttcaagtcatga
O02703_BAX-01       -----------------------------------------------------
O02703_BAX-02       ttcaggggggtggggcggatttgggggccatggagtttttcttacttttttaa
                                                                         

© 1998-2020Legal notice