Dataset for CDS BCL2A1 of organism Ailuropoda melanoleuca

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1LIJ8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2A1 (length=657 residues).
atgcacacagaaattccaccggcctccacgcctcccatgagtcacggtcccagccccgcaggcactcgcctatttggcct
cggctgctggcggcggagcagacggccggctggccagcggggcgggtggaagatgacagactgcgagttcgggtacaccc
tgacgctggcccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcggcccccagcagggcgtcccaggtg
ctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagttttgatgtggtgtc
cgtcgactccgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaaggattg
tgaccatatttgcgtttgaagggattctcaccaagaaactcctccgggagcgaatttccccagatgtggacgcttctagg
atttcttacttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctgggaagacggctt
tgtaaagaagttcgaacccaagtctggctggctgacttttctggaagttacggggaagatctgtgaaatgttctctctcc
tgaagcaatactgctga
© 1998-2022Legal notice