Dataset for CDS Unclassified of organism Biomphalaria glabrata

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A182YU15_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Biomphalaria glabrata (length=747 residues).
atgtctgtcgacagcgttgctaataactcatttgatatgaggcagaataagcttatggccggcaacaataaaaatttatt
tgctcaagtgacgcaaagatttggtgttcttgcggttcctggtcaaggattaaatgacatttcacaagttacagaagaga
gcactcaaacaatttctaattcccccttagaacaagttagacgtgatgctgaattcatggcggaagatgtcgttttaaat
tttgtggaagaaagtccaaaaaaagctcccaacagatactgtaaaaccttaagaagaactgtaaaagaactgtctgatcg
acatgatttagtcttcaaaggaatggtaaacagattaaaactagatgaaaataatgcgtttcaaacatttgttattgtcg
cagatgagatatttgaagatggacatgtgaactggggaagaatagttgctgtttatacctttgccgcaagggtggctaaa
tattattcagacactgttagtaaatgtgagattgataaagtgagtgatccaatggtaaagacgaaatctcaacaaaagaa
aatcgcactatttgtgggaaagtatgttgcaaacaaacttggaaagtggattcttgatcatggaggctgggatgcttttg
ttgagtactttccagaccaaggagagtttgaagagaagatgtggaaaggtgtgctgtttactgctattggtcttggtgca
cttgctactgttgttgcctcaagataa
>gnl|bcl2dbcds|A0A182YU15_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Biomphalaria glabrata (length=747 residues).
atgtctgtcgacagcgttgctaataactcatttgatatgaggcagaataagcttatggccggcaacaataaaaatttatt
tgctcaagtgacgcaaagatttggtgttcttgcggttcctggtcaaggattaaatgacatttcacaagttacagaagaga
gcactcaaacaatttctaattcccccttagaacaagttagacgtgatgctgaattcatggcggaagatgtcgttttaaat
tttgtggaagaaagtccaaaaaaagctcccaacagatactgtaaaaccttaagaagaactgtaaaagaactgtctgatcg
acatgatttagtcttcaaaggaatggtaaacagattaaaactagatgaaaataatgcgtttcaaacatttgttattgtcg
cagatgagatatttgaagatggacatgtgaactggggaagaatagttgctgtttatacctttgccgcaagggtggctaaa
tattattcagacactgttagtaaatgtgagattgataaagtgagtgatccaatggtaaagacgaaatctcaacaaaagaa
aatcgcactatttgtgggaaagtatgttgcaaacaaacttggaaagtggattcttgatcatggaggctgggatgcttttg
ttgagtactttccagaccaaggagagtttgaagagaagatgtggaaaggtgtgctgtttactgctattggtcttggtgca
cttgctactgttgttgcctcaagataa
>gnl|bcl2dbcds|A0A2C9KXW1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Biomphalaria glabrata (length=1086 residues).
atgtcattccgcaagaacaaaaagtccaccaagaaaggatcttttgtaccagaagctgatttccaagtgaatatttcaga
tgatgaaaacactccagctttgaaacttccacctgcacagccgattaatattactgacaataaagctgatagaaatgaaa
cttcaggatctctactgtttatcaatgctgaaccgcctccgcccccaccatcacactcttccaggtccaattcatccagt
ccgccagcatccaacctggcctctagctcctcaactaactaccccgccagtgacgtgacattgaatactataggatctag
cgcccacagtaatgctttggatgacccaggagaagatattgactatatggacattgagccatatgaattaaccagtccag
tcagtgatgtcagaaacaactttggtctagtgccgaggaagatgtccgcttctaaatttttggactctgggggtataaaa
catttacagttgctggcccaagcccaccaagaaagcaggtccaaacttgatagaatctcaggatcaaaaatgaatgctga
tgctgtagatggagctaacaaagagcatgacaacaagcaagaagcacctcagagacagaagagcaaggaggagctatatg
ggaaaattgccaagaagctggcggaaatggctgaccagtactcatcggaatcagcagaagcaaatggtgcagcagcttca
gcacctctctcagatttagagaaagaaatcatatcttgccttaggtcagaaggagatcgcaactctgctattattgaaga
gaagtttgaagctatggctgcccagacagcagatgaagcttaccagagattcaaaagcaccatcaaaagttccgtcaaca
atgagctaagttgggatcacctagcctttgtattctacacgaccaaagctgtgatctctgctgtgggtaaaggaacgaag
gcagccagtaaagctaaagaatattctttagaatatattagcgacacttttgcaacatggataatggatcaaggtggatt
cgacactatcatgagtagcagtgattcagattttgatgtagactga
© 1998-2022Legal notice