Dataset for CDS Unclassified of organism Sparus aurata

[Download (right click)]

8 sequence(s)

>gnl|bcl2dbcds|A0A671TM16_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=930 residues).
atggattctctcctcaccttcacactcttcttttttgtttggctctggaactcctgccacttcttcctcacagcacccca
gtcacgcaggctacatgggctggagggggacatcttttcgtgctgccagacctcgtccactaagacgcccatctcctccg
cagtaaacgatggtgcccgcttgtttcttttgctgccggtttcttccattctcacgtgtgtgtcagcatatctacagggg
tatatatgcgctaatgggcttgattgctacttggatacacctgttggcacacacacacacccccgcacacacacaccccc
acacacacgatacatgcgtaccgtggacaccgagaccaggcaactcatgcaacatttcctaagcgaatttgtggggacaa
ggaaacctaggtgggatgaaagcaaggctctgtcaactatgaaaagagttgtgggtgaagtattggagaaacacagatat
gtctacaatggtatgctcaacaaactttcattggaccacagaggggatgatgtgggattcatcagctcagtggctaccat
tctctttgcatatgggacgactaactggggccggattgccagcttgacagccttcagggctgtgttgtgtctgtacttca
aggagaagggaagagacaactgtgtagagctggtaggagaggaaatttccaactacctgctgactgagcagactgactgg
ctggttgaaaatgactcctggcatggctttgtggagttctttcgagttgcagagcccgaatcgacattgaggaacacact
ggtgaccgttgctggatttggaattggggcaacactgacattgttgatcatgttatcaatacgttgcaccttagacagtc
ctgcaggatgcacaaccttatttctacatatgaagttgttatggaaatga
>gnl|bcl2dbcds|A0A671TM16_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=591 residues).
atgaagacattacaaactcagcaggaaagcggtgatgtggcagaggatggtgataacaaagccgtggacaccgagaccag
gcaactcatgcaacatttcctaagcgaatttgtggggacaaggaaacctaggtgggatgaaagcaaggctctgtcaacta
tgaaaagagttgtgggtgaagtattggagaaacacagatatgtctacaatggtatgctcaacaaactttcattggaccac
agaggggatgatgtgggattcatcagctcagtggctaccattctctttgcatatgggacgactaactggggccggattgc
cagcttgacagccttcagggctgtgttgtgtctgtacttcaaggagaagggaagagacaactgtgtagagctggtaggag
aggaaatttccaactacctgctgactgagcagactgactggctggttgaaaatgactcctggcatggctttgtggagttc
tttcgagttgcagagcccgaatcgacattgaggaacacactggtgaccgttgctggatttggaattgggcatctcatcaa
acggaaggttgtcagtgtccacacactgtaa
>gnl|bcl2dbcds|A0A671U992_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=1032 residues).
atggcattccctgaatacttgatgtactccactggtgggtacgttatgctagatgctgtaaaatactgcatcatatgtgc
atgtccagaacgcgagcatgatcttgaatcatgccttgacatgcgcgaccgtctcaagaagaggctcaaggacctgaagt
tgccagtgcccattgacaacattcccctgtttgggacgacacttgaccctggcctcgaatgcgacggtaccttagtggat
actcgagagaacaacaagttccttgtccttggagatcctgccaacatgtaccaccttgagccaacgactgacacacacag
atgcttcatgtgtacaatcacagttaaggactttgtggagaatgacaccttactgggtgagcacatctatcatgcctaca
cccaaggcaaggactgcccataccttatcaaaaggttcaagggcaaccactccggcagtgaaactaacaaggggggaaac
acagcctcggctagtgagccggtcttgagataccctgaggatgaagctctggagactgtcaccaggcaactcatgaaatc
tttcttaggagaattcacaggactgttgaaacctatgccacaccgcagtaaagctctgtggacaatgagaagggttgttg
acgacatattggagacacacaaatgtgactacaacggtatgattgaccaactttccttggatagcagagataacgtggaa
ttcgtcagtgcagtggctaatagcctcttttctgatgggaccagcaactggtgtcgcgttgccagtctgacagccttcgg
ggcagtggtgtgtcagtacttcaaggacaagggcaaagactcctatgtagagatggtgggagatgagattgccttgtacc
tcctgaccaaacagaaggattggctgattgacaacaactcctgggatggctttgtgggctactttcgaccagcagactca
acatctaccctgatgaacatcatcactgtgtttgctggtgttgggataatgttgaccttgctgaacatgtga
>gnl|bcl2dbcds|A0A671U992_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=567 residues).
ccacaactatggttgtcattcacgagtgtactcaaaatgtttgggttgcaacttctacaggaagccggcagtgaaactaa
caaggggggaaacacagcctcggctagtgagccggtcttgagataccctgaggatgaagctctggagactgtcaccaggc
aactcatgaaatctttcttaggagaattcacaggactgttgaaacctatgccacaccgcagtaaagctctgtggacaatg
agaagggttgttgacgacatattggagacacacaaatgtgactacaacggtatgattgaccaactttccttggatagcag
agataacgtggaattcgtcagtgcagtggctaatagcctcttttctgatgggaccagcaactggtgtcgcgttgccagtc
tgacagccttcggggcagtggtgtgtcagtacttcaaggacaagggcaaagactcctatgatggctttgtgggctacttt
cgaccagcagactcaacatctaccctgatgaacatcatcactgtgtttgctggtgttgggataatgttgaccttgctgaa
catgtga
>gnl|bcl2dbcds|A0A671U992_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=549 residues).
gttttctgtcatgtaataaaagcttacattgttttcaatctcgtctctgggctggctgcactgcaactcatgaaatcttt
cttaggagaattcacaggactgttgaaacctatgccacaccgcagtaaagctctgtggacaatgagaagggttgttgacg
acatattggagacacacaaatgtgactacaacggtatgattgaccaactttccttggatagcagagataacgtggaattc
gtcagtgcagtggctaatagcctcttttctgatgggaccagcaactggtgtcgcgttgccagtctgacagccttcggggc
agtggtgtgtcagtacttcaaggacaagggcaaagactcctatgtagagatggtgggagatgagattgccttgtacctcc
tgaccaaacagaaggattggctgattgacaacaactcctgggatggctttgtgggctactttcgaccagcagactcaaca
tctaccctgatgaacatcatcactgtgtttgctggtgttgggataatgttgaccttgctgaacatgtga
>gnl|bcl2dbcds|A0A671U992_uncMCL1-04 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=597 residues).
atgtttgggttgcaacttctacaggaagccggcagtgaaactaacaaggggggaaacacagcctcggctagtgagccggt
cttgagataccctgaggatgaagctctggagactgtcaccaggcaactcatgaaatctttcttaggagaattcacaggac
tgttgaaacctatgccacaccgcagtaaagctctgtggacaatgagaagggttgttgacgacatattggagacacacaaa
tgtgactacaacggtatgattgaccaactttccttggatagcagagataacgtggaattcgtcagtgcagtggctaatag
cctcttttctgatgggaccagcaactggtgtcgcgttgccagtctgacagccttcggggcagtggtgtgtcagtacttca
aggacaagggcaaagactcctatgtagagatggtgggagatgagattgccttgtacctcctgaccaaacagaaggattgg
ctgattgacaacaactcctgggatggctttgtgggctactttcgaccagcagactcaacatctaccctgatgaacatcat
cactgtgttttcttgtgcaaataacatttattggtga
>gnl|bcl2dbcds|A0A671X3I9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=645 residues).
atgcgacggtaccttggtggatactcgggagaacaacaagtactcaaaatgcttgggttacaacgtctacgggtaaccgg
cagcgaaactaacaaaggtggcaacacaagcccggctagtgagccggtcttgagataccccgacgataaagctctggaca
ctgtcaccaggcaactcatgaaatctttcttaggagaattcacaggactgttgaaacctacgccacaccgcagtaaagct
ctgtggacaatgaaaagggttgttgacgacatattgaagacacacaaatgtgaatacaacggtatgattgaccaactttc
cttggacaaaagagataccgtgacgttcgtcagtgcagtggcaaatagcctcttttctgatgggaccagcaactggggtc
gtgttgccagtctgacagccttcggggcagtggtgtgtcagtacttcaaggacaagggcagagactcccatgtagagatg
gtggcagaagagcttgcctcgtacctcctgaccaaacagaaggattggttgattaacaacaactactgggtgggtgggtg
tgttgctcgagtgcaacacctgaccaaactctacacttggccacttggctgcagcatgctgtccgcatcactccagtcaa
cgtag
>gnl|bcl2dbcds|A0A671X3I9_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata (length=612 residues).
atgactgtgtcatttgtgtgcatccatcatgcatgtgtttggcttagcactcagtggcatcacgtactcaaaatgcttgg
gttacaacgtctacgggtaaccggcagcgaaactaacaaaggtggcaacacaagcccggctagtgagccggtcttgagat
accccgacgataaagctctggacactgtcaccaggcaactcatgaaatctttcttaggagaattcacaggactgttgaaa
cctacgccacaccgcagtaaagctctgtggacaatgaaaagggttgttgacgacatattgaagacacacaaatgtgaata
caacggtatgattgaccaactttccttggacaaaagagataccgtgacgttcgtcagtgcagtggcaaatagcctctttt
ctgatgggaccagcaactggggtcgtgttgccagtctgacagccttcggggcagtggtgtgtcagtacttcaaggacaag
ggcagagactcccatgtagagatggtggcagaagagcttgcctcgtacctcctgaccaaacagaaggattggttgattaa
caacaactactgggtgggtggcatgctgtccgcatcactccagtcaacgtag
© 1998-2020Legal notice