Dataset for CDS MCL-1 of organism Erpetoichthys calabaricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4RFB4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=MCL-1 (length=888 residues).
atgaatcctgcgcttgcaactatgaaccgcagccccgctaccagcctagtccagatgttatactgctctggaccgtcggg
tttgaatggcgtttttaagcacgatgccctgcatcttgcgaagggggctgactttacgggaagcacgcaaatgatgtcgg
tgcagctggatgaaggcgagctagacgattgtttggatgaggtcgattcagtctcgcagcttcacaagtcctcgtcgaag
aattgcttaaaaaatctcctgttctcggccgagagctcaaatgcagatggctctcttccagcatctccggagacgccttc
tagcccaatggacagcagtcagcccggatttacgcctgctgctgacgcccagctggcgcaggaaacagaggagcttattg
cggcctacttatttcgatcggccggattaccctgctcacgtatccgtaatggaaacaaatctttcgacacccttgtacgt
gttggggattctgtcatcgagaaacataaattcgcgtttaacggaatgctccggaagcttaatatctcccaggagggaga
catgggattcatgacccctgttgctgaaagcatcttcagcgatggagtgataaactggggacgtgttgtaagcttggtag
cgtttggggcagtggtagccaagcacctaaagcaagtcaacctagaacgctgcatcaggcctttggcagaccagatttct
actttcctgcttacacgccaaaaggattggattgtgaataacagagcttgggagggctttgtagagttctttcgcattga
agatccagaagcaggaatacgacaggccttgatcacctttgctggaatggcaggcattggagctggtattgcttatttga
tccgatga
© 1998-2022Legal notice