Dataset for CDS BCL2L1 of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A671K7W7_BCL2L1-      atgtcttactataaccgagaactggtggtattttttattaaatataaact
A0A671K7W7_BCL2L1-      atgtcttactataaccgagaactggtggtattttttattaaatataaact
A0A671QPE4_BCL2L1-      atgtcttactataaccgagaactggtggtattttttattaaatataaact

A0A671K7W7_BCL2L1-      ctcgcagaggaactacccctacaaccacattgaatttacagaagacacaa
A0A671K7W7_BCL2L1-      ctcgcagaggaactacccctacaaccacattgaatttacagaagacacaa
A0A671QPE4_BCL2L1-      ctcacagaggaactacccctacaatcacattgaatttacagaagacacaa
                        *** ******************** *************************

A0A671K7W7_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacg
A0A671K7W7_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacg
A0A671QPE4_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacg
                        ************************************ *************

A0A671K7W7_BCL2L1-      acgaacctcattaatggctccctaaacggaacaagtactggttccactgg
A0A671K7W7_BCL2L1-      acgaacctcattaatggctccctaaacggaacaagtactggttccactgg
A0A671QPE4_BCL2L1-      acgaccctcgttaatggctccctgaacggaacaagtactggttccactgg
                        **** **** ************* **************************

A0A671K7W7_BCL2L1-      gaccccaccaaggtcccccacttcaaccccccagcatcagacgaacggga
A0A671K7W7_BCL2L1-      gaccccaccaaggtcccccacttcaaccccccagcatcagacgaacggga
A0A671QPE4_BCL2L1-      gaccccaccaaggtcccccgcttcaaccccccagcgtcagacaaacggga
                        ******************* *************** ****** *******

A0A671K7W7_BCL2L1-      ctgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgag
A0A671K7W7_BCL2L1-      ctgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgag
A0A671QPE4_BCL2L1-      ctgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgag
                        ************* ** *********************************

A0A671K7W7_BCL2L1-      tttgagctgcgatattcccaagcattcaacgacctgtcctcgcagctcca
A0A671K7W7_BCL2L1-      tttgagctgcgatattcccaagcattcaacgacctgtcctcgcagctcca
A0A671QPE4_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctcca
                        *********** **************************************

A0A671K7W7_BCL2L1-      catcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
A0A671K7W7_BCL2L1-      catcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
A0A671QPE4_BCL2L1-      catcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
                        *************** ** *******************************

A0A671K7W7_BCL2L1-      tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgccttt
A0A671K7W7_BCL2L1-      tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgccttt
A0A671QPE4_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttc
                        ******* ***************************************** 

A0A671K7W7_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccactagt
A0A671K7W7_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccactagt
A0A671QPE4_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgctagt
                        ******************************************** *****

A0A671K7W7_BCL2L1-      gggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagc
A0A671K7W7_BCL2L1-      gggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagc
A0A671QPE4_BCL2L1-      gggaaacatcgcggattggatgaccgtctacctagacaacaaaattcagc
                        ***** ********* **********************************

A0A671K7W7_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga
A0A671K7W7_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga
A0A671QPE4_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga

A0A671K7W7_BCL2L1-      aaagatgcagtggcagagagcagaaaatcacaagaaaacttcaagaagtg
A0A671K7W7_BCL2L1-      aaagatgcagtggcagagagcagaaaatcacaagaaaacttcaagaagtg
A0A671QPE4_BCL2L1-      aaagatgcagcggcagagagcagaaaatcacaagaaaacttcaagaagtg
                        ********** ***************************************

A0A671K7W7_BCL2L1-      gttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactca
A0A671K7W7_BCL2L1-      gttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactca
A0A671QPE4_BCL2L1-      gttgctggcgggaatgaccttgctcacgggggtcgtgggcgggtcactca
                        ******** ********************* ******* ***********

A0A671K7W7_BCL2L1-      ttgcacagaaacgcctgtga
A0A671K7W7_BCL2L1-      ttgcacagaaacgcctgtga
A0A671QPE4_BCL2L1-      ttgcacagaaacgcctgtga

© 1998-2021Legal notice