Dataset for CDS BCL2L2 of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A671DWB3_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A671DWB3_BCL2L2-      atggcggcggcggcggcggcggcgacagcggcagcgggggctgcgggcgg
                        ****** *  * **  * **  *     *    **    *  ** * *  

A0A671DWB3_BCL2L2-      tgtaggctataagctgagacagaagggttatgtttgtggagctgggcccg
A0A671DWB3_BCL2L2-      tcggggctccgggccggggcggcgacgccat-cttgtg--cccggggccg
                        *   ****    ** * * * *    *  **  *****   * *** ***

A0A671DWB3_BCL2L2-      --gggagggcccagcagctgatcc-----gctgcaccaagccatgcgggc
A0A671DWB3_BCL2L2-      gtggggaggccggggagggggccccagggggcgcaggggactacgggaac
                          ***  ****  * **  *  **     *  ***     * * * *  *

A0A671DWB3_BCL2L2-      agctggagatgagttcgagacccgcttccgtcgcaccttctctgatctgg
A0A671DWB3_BCL2L2-      ggcctg----gagtctgag------------------------gaactgg
                         **  *    ****  ***                        ** ****

A0A671DWB3_BCL2L2-      cggct---cagttgcatgt-------gaccccgggctc-agctcagcagc
A0A671DWB3_BCL2L2-      agcctggggagttgctgctggagccggagcccgagcccgagcccgaagag
                         * **    ******   *       ** **** ** * *** *      

A0A671DWB3_BCL2L2-      gcttcacccaggtctctgatgaactcttccaagggggtcccaactggggc
A0A671DWB3_BCL2L2-      gagcctccccggcccc------gcgcccccccgggagctccgg-------
                        *   * *** ** * *       * *  **  *** *  **         

A0A671DWB3_BCL2L2-      cgccttgtggccttctttgtctttggagctgcactgtgtgctgagagtgt
A0A671DWB3_BCL2L2-      -gccctg-ggcc-----tggctcgggagc--ccccggcagccaggag---
                         *** ** ****     ** **  *****  * * *   **   ***   

A0A671DWB3_BCL2L2-      caacaaggagatggagccacttgtgggacaagtgcaggagtggatggtgg
A0A671DWB3_BCL2L2-      ----gaggaggaggagcc------gggactggtgga-gagtg--------
                             *****  ******      *****  *** * *****        

A0A671DWB3_BCL2L2-      cctacctggagacacggctagctgactggatccacagcagtgggggctgg
A0A671DWB3_BCL2L2-      ---acccggggg-acgg-----------------cgccattgaggacccg
                           *** ** *  ****                 *  ** ** ** *  *

A0A671DWB3_BCL2L2-      gagctggaagcgattaaagcgcgagtcagggagatggaggaagaagctga
A0A671DWB3_BCL2L2-      gagctggaagcgattaaagcgcgagtcagggagatggaggaagaagctga

A0A671DWB3_BCL2L2-      aaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtc
A0A671DWB3_BCL2L2-      aaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtc

A0A671DWB3_BCL2L2-      cacctccaggcaatgctggcccagtgattatgtctattgaggagaagatg
A0A671DWB3_BCL2L2-      cacctccaggcaatgctggcccagtgattatgtctattgaggagaagatg

A0A671DWB3_BCL2L2-      gaggctgatgcccgttccatctatgttggcaatgtagactatggtgcaac
A0A671DWB3_BCL2L2-      gaggctgatgcccgttccatctatgttggcaatgtagactatggtgcaac

A0A671DWB3_BCL2L2-      agcagaagagctggaagcacactttcatggctgtggctcagtcaaccgtg
A0A671DWB3_BCL2L2-      agcagaagagctggaagcacactttcatggctgtggctcagtcaaccgtg

A0A671DWB3_BCL2L2-      ttaccatactctgtgacaaatttagtggccaccccaaagggtttgcatat
A0A671DWB3_BCL2L2-      ttaccatactctgtgacaaatttagtggccaccccaaagggtttgcatat

A0A671DWB3_BCL2L2-      atagagttctcagacaaagagtcagtgaggacttccctggccttagatga
A0A671DWB3_BCL2L2-      atagagttctcagacaaagagtcagtgaggacttccctggccttagatga

A0A671DWB3_BCL2L2-      gtccctgtttagaggaagacaaatcaaggtgatcccaaaacgaaccaaca
A0A671DWB3_BCL2L2-      gtccctgtttagaggaagacaaatcaaggtgatcccaaaacgaaccaaca

A0A671DWB3_BCL2L2-      gaccaggcatcagcacaacagaccggggtttcccaagagcccgataccgt
A0A671DWB3_BCL2L2-      gaccaggcatcagcacaacagaccggggtttcccaagagcccgataccgt

A0A671DWB3_BCL2L2-      gcccggaccaccaactacaacagttcccgctctcgattctacagtggttt
A0A671DWB3_BCL2L2-      gcccggaccaccaactacaacagttcccgctctcgattctacagtggttt

A0A671DWB3_BCL2L2-      caacagcaggccccggggtcgcgtctacaggggccgggctagagcgactt
A0A671DWB3_BCL2L2-      caacagcaggccccggggtcgcgtctacaggggccgggctagagcgactt

A0A671DWB3_BCL2L2-      catggtattccccttactaa
A0A671DWB3_BCL2L2-      catggtattccccttactaa

© 1998-2021Legal notice