Dataset for CDS BCL2L2 of organism Rhinolophus ferrumequinum

[Download (right click)] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A671DWB3_BCL2L2-01      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A671DWB3_BCL2L2-02      atggcggcggcggcggcggcggcgacagcggcagcgggggctgcgggcgg
                          ****** *  * **  * **  *     *    **    *  ** * *  

A0A671DWB3_BCL2L2-01      tgtaggctataagctgagacagaagggttatgtttgtggagctgggcccg
A0A671DWB3_BCL2L2-02      tcggggctccgggccggggcggcgacgccatctt-gt-------------
                          *   ****    ** * * * *    *  ** ** **             

A0A671DWB3_BCL2L2-01      gggagggcccagcagctgatccgctgcaccaagccatgcgggcagctgga
A0A671DWB3_BCL2L2-02      -------------------------gcccggggccggtggggaggccggg
                                                   ** *   ***    ***  ** ** 

A0A671DWB3_BCL2L2-01      gatgagttcgagacccgcttccgtcgcaccttctctgatctggcggctca
A0A671DWB3_BCL2L2-02      gagggggccc----------------------------------------
                          ** * *  *                                         

A0A671DWB3_BCL2L2-01      gttgcatgtgaccccgggctcagctcagcagcgcttcacccaggtctctg
A0A671DWB3_BCL2L2-02      -----------cagggggcgcaggggactacgggaacggcctggagtctg
                                     *   **** ***   *  *  *   *  ** **  ****

A0A671DWB3_BCL2L2-01      atgaactcttcca-agggggtcccaactggggccgcc-------------
A0A671DWB3_BCL2L2-02      aggaactggagcctggggagttgctgctggagccggagcccgagcccgag
                          * *****    *   *** **  *  **** ****               

A0A671DWB3_BCL2L2-01      ------ttgtggccttctttgtctttggagctgcactgtgtgctgagagt
A0A671DWB3_BCL2L2-02      cccgaagaggagcctccccggcccc--gcgcccccccgggagctccgggc
                                  *  **** *   * *    * **  * * * * ***  * * 

A0A671DWB3_BCL2L2-01      -gtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatgg
A0A671DWB3_BCL2L2-02      cctgggcctggctcgggagcccccg-gcagccaggaggaggaggaggagc
                            *   *  **    ****** *      * ** * * *****  *  * 

A0A671DWB3_BCL2L2-01      tggcctacctggagacacggctagctgactggatccacagcagtgggggc
A0A671DWB3_BCL2L2-02      cgggactggtggagagtgacccgg------gggacggcgccattgaggac
                           **      ******     *  *      **  *  *  ** ** ** *

A0A671DWB3_BCL2L2-01      tgggagctggaagcgattaaagcgcgagtcagggagatggaggaagaagc
A0A671DWB3_BCL2L2-02      ccggagctggaagcgattaaagcgcgagtcagggagatggaggaagaagc
                            ************************************************

A0A671DWB3_BCL2L2-01      tgaaaagctaaaggagctacagaacgaggtagagaagcagatgaatatga
A0A671DWB3_BCL2L2-02      tgaaaagctaaaggagctacagaacgaggtagagaagcagatgaatatga
                          **************************************************

A0A671DWB3_BCL2L2-01      gtccacctccaggcaatgctggcccagtgattatgtctattgaggagaag
A0A671DWB3_BCL2L2-02      gtccacctccaggcaatgctggcccagtgattatgtctattgaggagaag
                          **************************************************

A0A671DWB3_BCL2L2-01      atggaggctgatgcccgttccatctatgttggcaatgtagactatggtgc
A0A671DWB3_BCL2L2-02      atggaggctgatgcccgttccatctatgttggcaatgtagactatggtgc
                          **************************************************

A0A671DWB3_BCL2L2-01      aacagcagaagagctggaagcacactttcatggctgtggctcagtcaacc
A0A671DWB3_BCL2L2-02      aacagcagaagagctggaagcacactttcatggctgtggctcagtcaacc
                          **************************************************

A0A671DWB3_BCL2L2-01      gtgttaccatactctgtgacaaatttagtggccaccccaaagggtttgca
A0A671DWB3_BCL2L2-02      gtgttaccatactctgtgacaaatttagtggccaccccaaagggtttgca
                          **************************************************

A0A671DWB3_BCL2L2-01      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
A0A671DWB3_BCL2L2-02      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
                          **************************************************

A0A671DWB3_BCL2L2-01      tgagtccctgtttagaggaagacaaatcaaggtgatcccaaaacgaacca
A0A671DWB3_BCL2L2-02      tgagtccctgtttagaggaagacaaatcaaggtgatcccaaaacgaacca
                          **************************************************

A0A671DWB3_BCL2L2-01      acagaccaggcatcagcacaacagaccggggtttcccaagagcccgatac
A0A671DWB3_BCL2L2-02      acagaccaggcatcagcacaacagaccggggtttcccaagagcccgatac
                          **************************************************

A0A671DWB3_BCL2L2-01      cgtgcccggaccaccaactacaacagttcccgctctcgattctacagtgg
A0A671DWB3_BCL2L2-02      cgtgcccggaccaccaactacaacagttcccgctctcgattctacagtgg
                          **************************************************

A0A671DWB3_BCL2L2-01      tttcaacagcaggccccggggtcgcgtctacaggggccgggctagagcga
A0A671DWB3_BCL2L2-02      tttcaacagcaggccccggggtcgcgtctacaggggccgggctagagcga
                          **************************************************

A0A671DWB3_BCL2L2-01      cttcatggtattccccttactaa
A0A671DWB3_BCL2L2-02      cttcatggtattccccttactaa
                          ***********************

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice