Dataset for CDS MCL-1 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5W0W9_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgg
A0A2K5W0W9_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgg
I7G687_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        *********************************************** **

A0A2K5W0W9_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5W0W9_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
I7G687_MCL1-01          gggggccggcttgggggccggcagcagcggcgccacccctccgggagggc
                        ************************* ************************

A0A2K5W0W9_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5W0W9_MCL1-03      ggctttt-------------------------------------------
I7G687_MCL1-01          ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
                        *******                                           

A0A2K5W0W9_MCL1-01      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
                                                                          

A0A2K5W0W9_MCL1-01      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
                                                                          

A0A2K5W0W9_MCL1-01      cggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
                                                                          

A0A2K5W0W9_MCL1-01      cccacccgccgcgcggggccgcttgaggagatggaagccccggccgccga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
                                                                          

A0A2K5W0W9_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
                                                                          

A0A2K5W0W9_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
                                                                          

A0A2K5W0W9_MCL1-01      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
                                                                          

A0A2K5W0W9_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
                                                                          

A0A2K5W0W9_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K5W0W9_MCL1-03      ----------------ggccaccggcgccaaggacacaaagccaatgggc
I7G687_MCL1-01          ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                                        **********************************

A0A2K5W0W9_MCL1-01      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A2K5W0W9_MCL1-03      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
I7G687_MCL1-01          aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
                        **************************************************

A0A2K5W0W9_MCL1-01      ggatggcgtgcagcgcaaccacgagacggccttccaa-------------
A0A2K5W0W9_MCL1-03      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
I7G687_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                        *************************************             

A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
I7G687_MCL1-01          aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                                                                          

A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
I7G687_MCL1-01          gtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
                                                                          

A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaag
I7G687_MCL1-01          catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaag
                                                                          

A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
I7G687_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                          

A0A2K5W0W9_MCL1-01      -----------------------------------ggatgggtttgtgga
A0A2K5W0W9_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
I7G687_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                                                           ***************

A0A2K5W0W9_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K5W0W9_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
I7G687_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
                        **************************************************

A0A2K5W0W9_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K5W0W9_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
I7G687_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

A0A2K5W0W9_MCL1-01      tagccttactgtaa
A0A2K5W0W9_MCL1-03      tag-----------
I7G687_MCL1-01          tag-----------
                        ***           

© 1998-2020Legal notice