Dataset for CDS BAX-like of Organism Chelydra serpentina

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C3RNW8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelydra serpentina GN=BAK1 (length=600 residues).
actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccctgccaatcattgtctctccctcaga
agatcaggtggctcaggagaccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagggaagagggcg
aaggtgaggtgccaatggaccctgagattgcagagatccagcaggagccgggcagcaccagcaaccaggtgggcaggcgc
ctggccatcatcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctgaagaccctgcagcccacgaa
ggacaatgcctatgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgctat
gtcgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagcctggcttttt
ttctctgctgggccggttaggccaaaatgttcaaacttag
>gnl|bcl2dbcds|A0A8C3RNW8_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelydra serpentina GN=BAK1 (length=588 residues).
actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccctgccaatcattgtctctccctcaga
agatcaggtggctcaggagaccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagggaagagggcg
aaggtgaggtgccaatggaccctgagattgcagagatccagcaggagccgggcagcaccagcaaccaggtgggcaggcgc
ctggccatcatcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctgaagaccctgcagcccacgaa
ggacaatgcctatgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgctat
gtcgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagcctgctgggct
ttgtgagcagtgttgctggtcaaattga
>gnl|bcl2dbcds|A0A8C3RTI8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Chelydra serpentina GN=BOK (length=642 residues).
atggaggtgctacgccgttcctcggtctttgctgcggaggtgatggaggtttttgatcggtctcccactgacaaggagct
ggtgtcccaggccaaggtgctctgcagagactacatacattcccggctgcttcgggctggcattggctggagcaaaccag
agcacagtgcacccacgcctggtggcagactggctgaggtgtccagtgtgcttctgcgactaggggacgagctggaatac
atcagaccaaatgtttaccggaatatcgcccgccagctgaacatctcactgcactccgagaccgtggtgactgatgcctt
cttggcagtagctgcccagatcttcacggcaggcgtaacatggggcaaggtcgtgtctctctatgctgtggccgctgggc
tggctgtggactgcgtcagacaggcccagccagcaatggtgcatgccattgtggactgcctgggagagtttgtccgcaag
accttggtgacatggctgaagaggagaggaggctgggcagacatcacaaaatgtgtggtgaataccgatcccagccttcg
ctctcattggcttgtggctgccatttgtagctttggtcacttcctgaaggccatcttctttgtactgttaccagagagat
ga
>gnl|bcl2dbcds|A0A8C3RTI8_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Chelydra serpentina GN=BOK (length=402 residues).
atgggaccaaatgtttaccggaatatcgcccgccagctgaacatctcactgcactccgagaccgtggtgactgatgcctt
cttggcagtagctgcccagatcttcacggcaggcgtaacatggggcaaggtcgtgtctctctatgctgtggccgctgggc
tggctgtggactgcgtcagacaggcccagccagcaatggtgcatgccattgtggactgcctgggagagtttgtccgcaag
accttggtgacatggctgaagaggagaggaggctgggcagacatcacaaaatgtgtggtgaataccgatcccagccttcg
ctctcattggcttgtggctgccatttgtagctttggtcacttcctgaaggccatcttctttgtactgttaccagagagat
ga
>gnl|bcl2dbcds|A0A8C3S4Y3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelydra serpentina GN=BAK1 (length=639 residues).
actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccctgccaatcattgtctctccctcaga
agatcaggtggctcaggagaccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagggaagagggcg
aaggtgaggtgccaatggaccctgagattgcagagatccagcaggagccgggcagcaccagcaaccaggtgggcaggcgc
ctggccatcatcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctgaagaccctgcagcccacgaa
ggacaatgcctatgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgctat
gttgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagcctggcttttt
ttctctgctgggccgggctagggtcagcacgattcctcgcttagctgggctttgtgagcagtgttgctggtcagattga
>gnl|bcl2dbcds|A0A8C3S4Y3_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelydra serpentina GN=BAK1 (length=588 residues).
actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccctgccaatcattgtctctccctcaga
agatcaggtggctcaggagaccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagggaagagggcg
aaggtgaggtgccaatggaccctgagattgcagagatccagcaggagccgggcagcaccagcaaccaggtgggcaggcgc
ctggccatcatcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctgaagaccctgcagcccacgaa
ggacaatgcctatgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgctat
gttgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagcctgctgggct
ttgtgagcagtgttgctggtcagattga
© 1998-2023Legal notice