Dataset for CDS BAX-like of Organism Chelydra serpentina

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3RTI8_BOK-01       atggaggtgctacgccgttcctcggtctttgctgcggaggtgatggaggt
A0A8C3RTI8_BOK-02       atgg----------------------------------------------
A0A8C3RNW8_BAK1-01      --------------------------------------------------
A0A8C3RNW8_BAK1-02      --------------------------------------------------
A0A8C3S4Y3_BAK1-01      --------------------------------------------------
A0A8C3S4Y3_BAK1-02      --------------------------------------------------
                                                                          

A0A8C3RTI8_BOK-01       ttttgatcggtctcccactgacaaggagctggtgtcccaggccaaggtgc
A0A8C3RTI8_BOK-02       --------------------------------------------------
A0A8C3RNW8_BAK1-01      --------------------------------------------------
A0A8C3RNW8_BAK1-02      --------------------------------------------------
A0A8C3S4Y3_BAK1-01      --------------------------------------------------
A0A8C3S4Y3_BAK1-02      --------------------------------------------------
                                                                          

A0A8C3RTI8_BOK-01       tctgcagagactacatacattcccggctgcttcgggctggcattggctgg
A0A8C3RTI8_BOK-02       --------------------------------------------------
A0A8C3RNW8_BAK1-01      ---------------------------------------------actgg
A0A8C3RNW8_BAK1-02      ---------------------------------------------actgg
A0A8C3S4Y3_BAK1-01      ---------------------------------------------actgg
A0A8C3S4Y3_BAK1-02      ---------------------------------------------actgg
                                                                          

A0A8C3RTI8_BOK-01       agcaaaccagagcacagtgcacccacgcctggtggcagactggctgaggt
A0A8C3RTI8_BOK-02       --------------------------------------------------
A0A8C3RNW8_BAK1-01      gtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccc
A0A8C3RNW8_BAK1-02      gtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccc
A0A8C3S4Y3_BAK1-01      gtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccc
A0A8C3S4Y3_BAK1-02      gtcaggccagaataagggcaccccgaccgcttttgctgcctgcctgaccc
                                                                          

A0A8C3RTI8_BOK-01       gtccagtgtgcttctgcgact-aggggacgagctggaatacatcagacca
A0A8C3RTI8_BOK-02       ---------------------------------------------gacca
A0A8C3RNW8_BAK1-01      tgccaatcattgtctctccctcagaagatcaggtgg--ctcaggagaccg
A0A8C3RNW8_BAK1-02      tgccaatcattgtctctccctcagaagatcaggtgg--ctcaggagaccg
A0A8C3S4Y3_BAK1-01      tgccaatcattgtctctccctcagaagatcaggtgg--ctcaggagaccg
A0A8C3S4Y3_BAK1-02      tgccaatcattgtctctccctcagaagatcaggtgg--ctcaggagaccg
                                                                     **** 

A0A8C3RTI8_BOK-01       a--atgtttaccggaatatcgc---------ccgccagctgaaca-----
A0A8C3RTI8_BOK-02       a--atgtttaccggaatatcgc---------ccgccagctgaaca-----
A0A8C3RNW8_BAK1-01      aggaggtgttccggagctatgccttctaccgctaccagcaggagagggaa
A0A8C3RNW8_BAK1-02      aggaggtgttccggagctatgccttctaccgctaccagcaggagagggaa
A0A8C3S4Y3_BAK1-01      aggaggtgttccggagctatgccttctaccgctaccagcaggagagggaa
A0A8C3S4Y3_BAK1-02      aggaggtgttccggagctatgccttctaccgctaccagcaggagagggaa
                        *  * ** * *****     **         *  ***** * * *     

A0A8C3RTI8_BOK-01       ----------------tctcactgcactccgagaccgtggtga-----ct
A0A8C3RTI8_BOK-02       ----------------tctcactgcactccgagaccgtggtga-----ct
A0A8C3RNW8_BAK1-01      gagggcgaaggtgaggtgccaatggaccctgagattgcagagatccagca
A0A8C3RNW8_BAK1-02      gagggcgaaggtgaggtgccaatggaccctgagattgcagagatccagca
A0A8C3S4Y3_BAK1-01      gagggcgaaggtgaggtgccaatggaccctgagattgcagagatccagca
A0A8C3S4Y3_BAK1-02      gagggcgaaggtgaggtgccaatggaccctgagattgcagagatccagca
                                        *  ** ** ** * ****  *  * **     * 

A0A8C3RTI8_BOK-01       gatgccttcttggcagtagctgc--ccagatcttcacggcaggcg-----
A0A8C3RTI8_BOK-02       gatgccttcttggcagtagctgc--ccagatcttcacggcaggcg-----
A0A8C3RNW8_BAK1-01      ggagcc----gggcagcaccagcaaccaggt-----gggcaggcgcctgg
A0A8C3RNW8_BAK1-02      ggagcc----gggcagcaccagcaaccaggt-----gggcaggcgcctgg
A0A8C3S4Y3_BAK1-01      ggagcc----gggcagcaccagcaaccaggt-----gggcaggcgcctgg
A0A8C3S4Y3_BAK1-02      ggagcc----gggcagcaccagcaaccaggt-----gggcaggcgcctgg
                        *  ***     ***** * * **  **** *      ********     

A0A8C3RTI8_BOK-01       -taacatggggcaaggtcgtgtctctctatgctgtggccgctgggct---
A0A8C3RTI8_BOK-02       -taacatggggcaaggtcgtgtctctctatgctgtggccgctgggct---
A0A8C3RNW8_BAK1-01      ccatcatcgg---agatgacatcaacatgcggtatga-cgcagagttccg
A0A8C3RNW8_BAK1-02      ccatcatcgg---agatgacatcaacatgcggtatga-cgcagagttccg
A0A8C3S4Y3_BAK1-01      ccatcatcgg---agatgacatcaacatgcggtatga-cgcagagttccg
A0A8C3S4Y3_BAK1-02      ccatcatcgg---agatgacatcaacatgcggtatga-cgcagagttccg
                          * *** **   ** *    **    *  * * **  *** * * *   

A0A8C3RTI8_BOK-01       -----ggctgtggactgcgtcagacaggcccagccagcaatggtgcatgc
A0A8C3RTI8_BOK-02       -----ggctgtggactgcgtcagacaggcccagccagcaatggtgcatgc
A0A8C3RNW8_BAK1-01      gaacatgctgaagaccctg-----------cagcccacgaaggacaatgc
A0A8C3RNW8_BAK1-02      gaacatgctgaagaccctg-----------cagcccacgaaggacaatgc
A0A8C3S4Y3_BAK1-01      gaacatgctgaagaccctg-----------cagcccacgaaggacaatgc
A0A8C3S4Y3_BAK1-02      gaacatgctgaagaccctg-----------cagcccacgaaggacaatgc
                              ****  ***   *           *****  * * **   ****

A0A8C3RTI8_BOK-01       cattgtggactgc-ctgggaga-----------gtttgtccgca------
A0A8C3RTI8_BOK-02       cattgtggactgc-ctgggaga-----------gtttgtccgca------
A0A8C3RNW8_BAK1-01      ctatgagtacttcactaagatagcctccagcttgtttgacagcggcatta
A0A8C3RNW8_BAK1-02      ctatgagtacttcactaagatagcctccagcttgtttgacagcggcatta
A0A8C3S4Y3_BAK1-01      ctatgagtacttcactaagatagcctccagcttgtttgacagcggcatta
A0A8C3S4Y3_BAK1-02      ctatgagtacttcactaagatagcctccagcttgtttgacagcggcatta
                        *  ** * *** * **  ** *           ***** * **       

A0A8C3RTI8_BOK-01       ---agaccttggtgacatggctgaagaggagaggaggctgggcaga----
A0A8C3RTI8_BOK-02       ---agaccttggtgacatggctgaagaggagaggaggctgggcaga----
A0A8C3RNW8_BAK1-01      actggggcagggtgattgcgctgctggggttcggttaccggatggcgatc
A0A8C3RNW8_BAK1-02      actggggcagggtgattgcgctgctggggttcggttaccggatggcgatc
A0A8C3S4Y3_BAK1-01      actggggcagggtgattgcgctgctggggttcggttaccggatggcgatc
A0A8C3S4Y3_BAK1-02      actggggcagggtgattgcgctgctggggttcggttaccggatggcgatc
                            *  *  *****    ****  * **   **   * **   *     

A0A8C3RTI8_BOK-01       ---------catcacaaaatgtgtggt--------gaataccg-------
A0A8C3RTI8_BOK-02       ---------catcacaaaatgtgtggt--------gaataccg-------
A0A8C3RNW8_BAK1-01      catgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgcta
A0A8C3RNW8_BAK1-02      catgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgcta
A0A8C3S4Y3_BAK1-01      catgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgcta
A0A8C3S4Y3_BAK1-02      catgtgtatcagcacggggtgaccggcttcctccggagcatcgcccgcta
                                 ** ***    **   **         **  * **       

A0A8C3RTI8_BOK-01       -atcccagccttcgctct---------cattggcttgtggct-gccattt
A0A8C3RTI8_BOK-02       -atcccagccttcgctct---------cattggcttgtggct-gccattt
A0A8C3RNW8_BAK1-01      tgtcgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgacc
A0A8C3RNW8_BAK1-02      tgtcgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgacc
A0A8C3S4Y3_BAK1-01      tgttgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgacc
A0A8C3S4Y3_BAK1-02      tgttgcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgacc
                          *  ***  ****  **         *** * *  **** * ***    

A0A8C3RTI8_BOK-01       --gtagctttggtcact--tcctgaag-----------------------
A0A8C3RTI8_BOK-02       --gtagctttggtcact--tcctgaag-----------------------
A0A8C3RNW8_BAK1-01      agggaggatgggtgagtgagcctggctttttttctct-------------
A0A8C3RNW8_BAK1-02      agggaggatgggtgagtgagcct---------------------------
A0A8C3S4Y3_BAK1-01      agggaggatgggtgagtgagcctggctttttttctctgctgggccgggct
A0A8C3S4Y3_BAK1-02      agggaggatgggtgagtgagcct---------------------------
                          * **  * *** * *   ***                           

A0A8C3RTI8_BOK-01       ------------------------gccatcttctttgtac-----tgtta
A0A8C3RTI8_BOK-02       ------------------------gccatcttctttgtac-----tgtta
A0A8C3RNW8_BAK1-01      ------------------------gctgggccggttaggccaaaatgt--
A0A8C3RNW8_BAK1-02      ------------------------gctgggctttgtgagc---agtgttg
A0A8C3S4Y3_BAK1-01      agggtcagcacgattcctcgcttagctgggctttgtgagc---agtgttg
A0A8C3S4Y3_BAK1-02      ------------------------gctgggctttgtgagc---agtgttg
                                                **         *   *     ***  

A0A8C3RTI8_BOK-01       ccagagaga-tga-
A0A8C3RTI8_BOK-02       ccagagaga-tga-
A0A8C3RNW8_BAK1-01      ----tcaaacttag
A0A8C3RNW8_BAK1-02      ctggtcaaattga-
A0A8C3S4Y3_BAK1-01      ctggtcagattga-
A0A8C3S4Y3_BAK1-02      ctggtcagattga-
                              * * * * 

© 1998-2023Legal notice