Dataset for CDS Unclassified of organism Oreochromis niloticus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|I3KWT0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus (length=594 residues).
atgcagtgcagtaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaacttcccttct
gaggccaaccaatgggggccaaaggactgagagagacctggcccaatctctgcctgcatacaatggcatagaggctttaa
aatcagctcttctagactcaggggagcagtttggttttctgttcacacagtcttttagggacgttgcttcgcacctcagc
atcacgccggacacagcccagcaatgcttcgagagcgtgatggaggagttgttcagggatggaatcaactgggggcgtat
aattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgagtgagctggtacccgacattg
cagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctttacagag
atatttgggaaagggatgtctacaaggagctctggggagtctctgaagagatggctatttgttggagtggccttagtaac
agggctgctggttggcatgctcatgacagattaa
© 1998-2020Legal notice