Dataset for CDS Unclassified of organism Oreochromis niloticus

[Download (right click)]

11 sequence(s)

>gnl|bcl2dbcds|A0A669B079_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus (length=555 residues).
atgttacacaatataccagaaccctcgctgtgtgtcacatcacaccatcacaagttgatatcaccccctatgtttttatg
ttgtctttggcggacagcaacagagtgtactttgaaaacttgcaattgtaataaccacacgcacgtccacacaggcatgc
tctcgctgcagaccaccgccgccgaagtgccaatggtcacaggtgtggcgcgcgccttgttttcagacggcattataaac
tggggacgcgtagtgagccttgtagcttacggcacagtgttactgcgagcgtcgaagtcaaccttgggacccgagtgcgc
ttacgagatcggcgtgtcgatagcggcctacattacagacaatcacatggattggcttgtgggctccgacggttgggatg
gattcgtgcacaccttcgaccgagtacaccaacggccgtggctgtcaacgcaaggaaagctgtttgtgtttggtgtggga
ttaggtttattgtcaaagcaaggaaagctgcttttgcttggtgtgggattaggtttattgtcagttttactatga
>gnl|bcl2dbcds|A0A669B428_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=1017 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggctccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcgcgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcactgcagatggagataaaaccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgt
cggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcatttgtggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggc
ttggctgcgctcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A669B428_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=1077 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggctccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcgcgagacgagaagttgcttcaggcaaagaaggaagtggagaaatttgccat
caatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaacagg
ctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtggag
gtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatgaa
ggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactccc
catctaagtttgccctgcgaggccttgcagagtcactgcagatggagataaaaccctacaatatctacgtgactgtggca
tacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaaac
ctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgtcg
gtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagatt
gtcaccatgggattgtttcggaccatcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattca
aagggagcagtcaaaagcggccaataagagggagtaa
>gnl|bcl2dbcds|A0A669B428_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=561 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggctccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcgcgagacgaggtggtgctctgcatctcagttgatgtttccagtgattacag
tcaagtggaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcag
tttctgggaagtttgaggaagtggaggtagatcgttttaaaattgtcaccatgggattgtttcggaccatcgcacttttt
tacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggccaataagagggagta
a
>gnl|bcl2dbcds|A0A669B428_uncBCL2-04 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=894 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggctccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcgcgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcactgcagatggagataaaaccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcaattgtcaccatgggattgtttcggac
catcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggcca
ataagagggagtaa
>gnl|bcl2dbcds|A0A669BN75_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus (length=522 residues).
atgaggggtcactcagcagccgcggagcagaagccagggggggttgcatgtccttggcggacagcaacagagtgtacttt
gaaaacttgcaattgtaataaccacacgcacgtccacacaggcatgctctcgctgcagaccaccgccgccgaagtgccaa
tggtcacaggtgtggcgcacgccttgttttcagacggcattataaactggggacgcgtagtgagccttgtagcttacggc
acagtgttactgcgagcgtcgaagtcaaccttgggacccgagtgcgcttacgagatcggcgtgtcgatagcggcctacat
tacagacaatcacatggattggcttgtgggctccgacggttgggacggattcgtgcacaccttcgaccgagtacaccaac
ggccgtggctgtcaacgcaaggaaagctgtttgtgtttggtgtgggattaggtttattgtcaaagcaaggaaagctgctt
ttgcttggtgtgggattaggtttattgtcagttttactatga
>gnl|bcl2dbcds|A0A669BV66_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Oreochromis niloticus (length=414 residues).
agcctgcttcttgattatatgtattattacaaatgcttgttatgtgatttaatgcaatgcatgctctcacttcagaccac
cgccgctgacgtgccaacggtcacagcaggtgtagcacgcgccttgttttcggacggcattataaactggggacgcatag
tgagccttgtggcttatggcacagtgttactgcaagcgtcgaagtcaaccttggggcccgagtgtgcttacgggattggc
gtgtcgatagcggcctacattacagaaaatcacatggattggcttgtgggcaccgatggttgggacggattcgtgcacac
cttcgaccaagtacaccaatggccgtggctgtcaacacaaggaaagctgtttgtgtttggtgtgggattaggtttattgt
cagttttactatga
>gnl|bcl2dbcds|A0A669CH56_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus (length=678 residues).
atggaacatttgccatggactcgggacaaacacagatgtgccgcttgcgatttggttctgcacagctttgtggtagggga
cacctttgtgggagagcacatctatcacatacacaaggaaggtaagcgttgtccgtatatcgacgcgagatacgaccgag
acgagatactctacgaactcggacggcaacgttcccggagaggacaactcgccttcccgagtcgcgtactcacagccgag
cggggctacagctccgtggccggtctggaacgatgcctagtgtgtggagttaccactatacaagaaaagtatctgccttc
gcttggccacgatgcctggtgttcagtaccctcgctgaatgtcacatcacaccacacaacacgcgccttgttttcggacg
gcattataaactggggacgcatagtgagccttgtggcttacggcacagtgttactgcaagcgtcgaagtcaaccttgtgg
ccggagtgcgcttacgggatcggcgtgtcgatagcggcctacattacagataatcacatggattggcttgtgggcacaga
tggttgggacggattcgtggacaccttcgaccgagtacaccaacggccgtggctgtcaacgcaaggaaagctgtttgttt
ttggtgtgggattaggtttattgtcagttttactatga
>gnl|bcl2dbcds|A0A669F4C0_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus (length=600 residues).
atgcgctgcttgcgatttggttctgcacagctttgtggtaggagacacctttgtgggagagcacatctattccatataca
accaaggcaagcgttgtccgtatatcgacgcgagatacgacagagacgagatactctacgaactcggacggcaacgttcc
cggagaggacaactcgccttaccgagtcgcgtactcacacaacagagtgtactttgaaaacttgcaattgtaataaccac
acgcacgtccacacaggcatgctctcgctgcagaccaccgccgccgaagtgccaatggtcacaggtgtggcgcgcgcctt
gttttcagacggcattataaactggggacgcgtagtgagccttgtagcttacggcacagtgttactgcgagcgtcgaagt
caaccttgggacccgagtgcgcttacgagattggcgtgtcgatagcggcctacattacagacaatcacatggattggctt
gtgggctccgacggttggtcggcctgctggttttgtacgagcgcaccaccggagttcgttcacttctgtcgtctaccgct
ttttctcatcccgtcgcttgcggctataagaatcacttga
>gnl|bcl2dbcds|I3KLB3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=603 residues).
ggggcgatggctgccgcctacaacagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggc
ttggcctcagcggcgggccaatgacgtgagagcgccgcgcccagacccccccgtggccccgccccgcctgcaggctgtgc
tgcggagcgccagcgatgagttggagcgacttcacggcaacgagctatctgcgcaggtgacagtgctgcgactgcgtggg
aacggcggcggtgctgcacgtcggcgccacctgacggctatcagagaggagctgttcagggacggcgtgaactggggacg
catcgtcaccatgatggagctgggcggagctctgagtgccgcagccgccaagtcgggcgacgaaggtcaggtggatgata
tcgccagctggatggaggagagtctggactctccgtcgctccgaagatggatccatgacaacggaggatgggatgctttt
gtggagctgtatgagtccagacccacagacagcttctggtccctgaggacagtgttaggactggtcgtactgggagcagt
tggggttatactgggatttctattcagccagaaacaaaactga
>gnl|bcl2dbcds|I3KWT0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus (length=594 residues).
atgcagtgcagtaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaacttcccttct
gaggccaaccaatgggggccaaaggactgagagagacctggcccaatctctgcctgcatacaatggcatagaggctttaa
aatcagctcttctagactcaggggagcagtttggttttctgttcacacagtcttttagggacgttgcttcgcacctcagc
atcacgccggacacagcccagcaatgcttcgagagcgtgatggaggagttgttcagggatggaatcaactgggggcgtat
aattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgagtgagctggtacccgacattg
cagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctttacagag
atatttgggaaagggatgtctacaaggagctctggggagtctctgaagagatggctatttgttggagtggccttagtaac
agggctgctggttggcatgctcatgacagattaa
© 1998-2021Legal notice