Dataset for CDS MCL-1 of organism Esox lucius

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1056 residues).
ctctcttattcctacagacagaacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgag
cgctgaggagttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgcc
agcgtgatcagaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctcta
gagcatgcggacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgg
gcagatccccatcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
gtgacatagcagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtacc
atcgccaacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctac
gaatgtggaggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggaca
ttcccatcccaacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacc
cgtagcaatgaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtc
gaacttcatcaccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcg
acaatcagagacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaag
atcggctaccacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattcgtca
acagaggctaagatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1077 residues).
cttgcagacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
tgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatcagacca
agaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcggacaga
gaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccccatcaa
tgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatagcagcca
tcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaacacagag
ggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtggaggagac
ccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcccaacgc
tgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaatgaccct
gtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcatcaccag
tgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcagagacaga
agctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctaccacttc
acccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattgtctatggttttcctacatg
cgatgatctgtcacataggcgtttcagtttcacatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1038 residues).
gaggcgtgtttgtacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgagga
gttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatc
agaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcg
gacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccc
catcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatag
cagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaac
acagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtgga
ggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcc
caacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaat
gaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcat
caccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcaga
gacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctac
cacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgagtgagcatctatag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=915 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcagacagagtcctgctcacccct
ggggttgtgaggcgtgtttgtgtgaccctagctag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=864 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcaggtga
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=603 residues).
atgagagtattttcaaaatcgaagatgtcgctaatctcccagggaaccggtgagtgtgttgacgaatgcagaaacagagc
ctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagactttactgaacatttgaaacctaggtggaacg
aaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaatggtatgctc
tacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggctcttcgcagatgg
gaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgtgccggtacctcaaggataagggcaaag
acaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagaccagagagactggctggtaaaaaacaac
tcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgagaaacgtactcctaacatttgctggctt
cggggcagcgctggccatgttgaaaatggtcgggtaccaatag
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=648 residues).
tgtctagagtgccacgtgccctatgctgtatacttattttcaaaatcgaagatgtcgctaatctcccagggaaccggtga
gtgtgttgacgaatgcagaaacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagacttta
ctgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaa
cacagatactcatacaatggtatgctctacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgt
aatcgctaacaggctcttcgcagatgggaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgt
gccggtacctcaaggataagggcaaagacaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagac
cagagagactggctggtaaaaaacaactcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgag
aaacgtactcctaacatttgctggcttcggggcagcgctggccatgttgaaaatgtatgtggtcactggaaagagtttgt
acatgtag
>gnl|bcl2dbcds|A0A6Q2XXK6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacgaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctggcttttgggcagcgctggtcatgttggacatgtaa
>gnl|bcl2dbcds|A0A6Q2Y9Q3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacaaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctgtgtcaatggtacactatattagggctgtgtactga
>gnl|bcl2dbcds|A0A6Q2YT18_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=588 residues).
atgagagtattttcaaaatcgaagatgtcgctaatctcccagggaaccggtgagtgtgttgacgaatgcagaaacagagc
ctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagactttactgaacatttgaaacctaggtggaacg
aaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaatggtatgctc
tacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggctcttcgcagatgg
gaccacaaactggggccgcgttatcagcctgctcgcgttcgggactgtggtgtgccggtacctcaaggataagggcaaag
acaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagaccagagagactggctggtaaaaaacaac
tcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgagaaacgtactcctaacatttgatgtagt
atacactctgtggatccgtttttcttag
>gnl|bcl2dbcds|A0A6Q2YT18_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=621 residues).
atgagagtattttcaaaatcgaagatgtcgctaatctcccagggaaccggtgagtgtgttgacgaatgcagaaacagagc
ctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagactttactgaacatttgaaacctaggtggaacg
aaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaatggtatgctc
tacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggctcttcgcagatgg
gaccacaaactggggccgcgttatcagcctgctcgcgttcgggactgtggtgtgccggtacctcaaggataagggcaaag
acaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagaccagagagactggctggtaaaaaacaac
tcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgagaaacgtactcctaacatttgctggctt
cagggcagcgctggccatgttgaaaatgtatgtggtcactggaaagaatttgtacatgtag
© 1998-2022Legal notice