Dataset for CDS MCL-1 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      ------------------atgaacctgtcgaaatcgcttacacgagcca-
A0A3P8Y1W8_MCL1-05      ------------------atgaacctgtcgaaatcgcttacacgagcca-
A0A3P8Y1W8_MCL1-01      ctctcttattcctacagacagaacatgtcaaaaagcgacccacgggacat
A0A3P8Y1W8_MCL1-02      --------cttgca-------gacatgtcaaaaagcgacccacgggacat
A0A3P8Y1W8_MCL1-03      gaggcgtgtttgt---------acatgtcaaaaagcgacccacgggacat
                                                                          

A0A6Q2XXK6_MCL1-01      -------------------------atgagcgg-----------------
A0A6Q2Y9Q3_MCL1-01      -------------------------atgagcgg-----------------
A0A6Q2YT18_MCL1-01      -------------------------atgagag------------------
A0A6Q2YT18_MCL1-02      -------------------------atgagag------------------
A0A6Q2XQM7_MCL1-01      -------------------------atgagag------------------
A0A6Q2XQM7_MCL1-02      -----------------------tgtctagagt-----------------
A0A3P8Y1W8_MCL1-04      caactacgatgc--------------tcaacgttca--------------
A0A3P8Y1W8_MCL1-05      caactacgatgc--------------tcaacgttca--------------
A0A3P8Y1W8_MCL1-01      cgacgaggatgccatcctcaaagggatgagcgctgaggagttagatgcgc
A0A3P8Y1W8_MCL1-02      cgacgaggatgccatcctcaaagggatgagcgctgaggagttagatgcgc
A0A3P8Y1W8_MCL1-03      cgacgaggatgccatcctcaaagggatgagcgctgaggagttagatgcgc
                                                    *  *                  

A0A6Q2XXK6_MCL1-01      ------------------agtatatccccagggatctaactttaccagcc
A0A6Q2Y9Q3_MCL1-01      ------------------agtatatccccagggatctaactttaccagcc
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      ------------------gccacgtgccctatgctgtatact--------
A0A3P8Y1W8_MCL1-04      ------------------aaatggagtcgtgggat----ctttgtattct
A0A3P8Y1W8_MCL1-05      ------------------aaatggagtcgtgggat----ctttgtattct
A0A3P8Y1W8_MCL1-01      tggagtatgagctgcaagagatggacccagagaatgccatgctgcctgca
A0A3P8Y1W8_MCL1-02      tggagtatgagctgcaagagatggacccagagaatgccatgctgcctgca
A0A3P8Y1W8_MCL1-03      tggagtatgagctgcaagagatggacccagagaatgccatgctgcctgca
                                                                          

A0A6Q2XXK6_MCL1-01      gggtaaccgttacagttaaagggtttggcatatccgcactaaagcgtaga
A0A6Q2Y9Q3_MCL1-01      gggtaaccgttacagttaaagggtttggcatatccgcactaaagcgtaga
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      ggtgcccctttgtgctatt---------ttagcccgacagggcccttatg
A0A3P8Y1W8_MCL1-05      ggtgcccctttgtgctatt---------ttagcccgacagggcccttatg
A0A3P8Y1W8_MCL1-01      gggttccgccagcgtgatcagaccaagaagagcccgacaggggttttcga
A0A3P8Y1W8_MCL1-02      gggttccgccagcgtgatcagaccaagaagagcccgacaggggttttcga
A0A3P8Y1W8_MCL1-03      gggttccgccagcgtgatcagaccaagaagagcccgacaggggttttcga
                                                                          

A0A6Q2XXK6_MCL1-01      gaaagtggtcagtacgaatcacctgagggg--------------------
A0A6Q2Y9Q3_MCL1-01      gaaagtggtcagtacgaatcacctgagggg--------------------
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      tcctgcggcctcttcgaagtccaaaatggacgttgatttaggaaatg-gg
A0A3P8Y1W8_MCL1-05      tcctgcggcctcttcgaagtccaaaatggacgttgatttaggaaatg-gg
A0A3P8Y1W8_MCL1-01      ccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcgg
A0A3P8Y1W8_MCL1-02      ccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcgg
A0A3P8Y1W8_MCL1-03      ccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcgg
                                                                          

A0A6Q2XXK6_MCL1-01      -----------ttgaaatcccataccgg----------------------
A0A6Q2Y9Q3_MCL1-01      -----------ttgaaatcccataccgg----------------------
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      actg-------ctgatactcctgtccga----------------------
A0A3P8Y1W8_MCL1-05      actg-------ctgatactcctgtccga----------------------
A0A3P8Y1W8_MCL1-01      acagagaagacctagtgcccttcactggagagaagaaagggagagcgttt
A0A3P8Y1W8_MCL1-02      acagagaagacctagtgcccttcactggagagaagaaagggagagcgttt
A0A3P8Y1W8_MCL1-03      acagagaagacctagtgcccttcactggagagaagaaagggagagcgttt
                                                                          

A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      ---cctacgaag-----------------------ttagaag--------
A0A3P8Y1W8_MCL1-05      ---cctacgaag-----------------------ttagaag--------
A0A3P8Y1W8_MCL1-01      gttcctaaggagggccacgggcagatccccatcaatgagcagatcaccct
A0A3P8Y1W8_MCL1-02      gttcctaaggagggccacgggcagatccccatcaatgagcagatcaccct
A0A3P8Y1W8_MCL1-03      gttcctaaggagggccacgggcagatccccatcaatgagcagatcaccct
                                                                          

A0A6Q2XXK6_MCL1-01      ---acctgatgtcgacaccattc-------------gaattttagtattt
A0A6Q2Y9Q3_MCL1-01      ---acctgatgtcgacaccattc-------------gaattttagtattt
A0A6Q2YT18_MCL1-01      ---------------------------------------------tattt
A0A6Q2YT18_MCL1-02      ---------------------------------------------tattt
A0A6Q2XQM7_MCL1-01      ---------------------------------------------tattt
A0A6Q2XQM7_MCL1-02      ---------------------------------------------tattt
A0A3P8Y1W8_MCL1-04      ------taaatatgacgaaaccc-----aacgtattggatagtcgtttgt
A0A3P8Y1W8_MCL1-05      ------taaatatgacgaaaccc-----aacgtattggatagtcgtttgt
A0A3P8Y1W8_MCL1-01      ggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
A0A3P8Y1W8_MCL1-02      ggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
A0A3P8Y1W8_MCL1-03      ggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
                                                                       * *

A0A6Q2XXK6_MCL1-01      tcaaaacagaagatg--tc---------------gctaatctcccaggga
A0A6Q2Y9Q3_MCL1-01      tcaaaacagaagatg--tc---------------gctaatctcccaggga
A0A6Q2YT18_MCL1-01      tcaaaatcgaagatg--tc---------------gctaatctcccaggga
A0A6Q2YT18_MCL1-02      tcaaaatcgaagatg--tc---------------gctaatctcccaggga
A0A6Q2XQM7_MCL1-01      tcaaaatcgaagatg--tc---------------gctaatctcccaggga
A0A6Q2XQM7_MCL1-02      tcaaaatcgaagatg--tc---------------gctaatctcccaggga
A0A3P8Y1W8_MCL1-04      cagacctggccgacgactccgacgactcattgccgtgcactcccctgatg
A0A3P8Y1W8_MCL1-05      cagacctggccgacgactccgacgactcattgccgtgcactcccctgatg
A0A3P8Y1W8_MCL1-01      gtgacatagcagcca--tcctgggaat-------gtaca---cactgatg
A0A3P8Y1W8_MCL1-02      gtgacatagcagcca--tcctgggaat-------gtaca---cactgatg
A0A3P8Y1W8_MCL1-03      gtgacatagcagcca--tcctgggaat-------gtaca---cactgatg
                           *    *  *     **               *   *   * * *   

A0A6Q2XXK6_MCL1-01      accggtgagt-gtatt----------------------tacgaacgcaga
A0A6Q2Y9Q3_MCL1-01      accggtgagt-gtatt----------------------tacaaacgcaga
A0A6Q2YT18_MCL1-01      accggtgagt-gtgtt----------------------gacgaatgcaga
A0A6Q2YT18_MCL1-02      accggtgagt-gtgtt----------------------gacgaatgcaga
A0A6Q2XQM7_MCL1-01      accggtgagt-gtgtt----------------------gacgaatgcaga
A0A6Q2XQM7_MCL1-02      accggtgagt-gtgtt----------------------gacgaatgcaga
A0A3P8Y1W8_MCL1-04      gttactgagt-gtagtgcgg------ggttatcacattgcccatcg--gg
A0A3P8Y1W8_MCL1-05      gttactgagt-gtagtgcgg------ggttatcacattgcccatcg--gg
A0A3P8Y1W8_MCL1-01      agcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaa
A0A3P8Y1W8_MCL1-02      agcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaa
A0A3P8Y1W8_MCL1-03      agcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaa
                               **  **  *                        * *  *    

A0A6Q2XXK6_MCL1-01      aacagagcctcgctggacacggagaccaggcaactcgtgaaatctttcct
A0A6Q2Y9Q3_MCL1-01      aacagagcctcgctggacacggagaccaggcaactcgtgaaatctttcct
A0A6Q2YT18_MCL1-01      aacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcct
A0A6Q2YT18_MCL1-02      aacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcct
A0A6Q2XQM7_MCL1-01      aacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcct
A0A6Q2XQM7_MCL1-02      aacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcct
A0A3P8Y1W8_MCL1-04      caatgaggtt--ttggacaacgataccagacaactcattgagaatttatt
A0A3P8Y1W8_MCL1-05      caatgaggtt--ttggacaacgataccagacaactcattgagaatttatt
A0A3P8Y1W8_MCL1-01      cacagagggc--atcaacagcgtcgtaaaacca---------gatccatt
A0A3P8Y1W8_MCL1-02      cacagagggc--atcaacagcgtcgtaaaacca---------gatccatt
A0A3P8Y1W8_MCL1-03      cacagagggc--atcaacagcgtcgtaaaacca---------gatccatt
                         *  ***      *  ***  *     *  * *           *    *

A0A6Q2XXK6_MCL1-01      agaagagtttactg--gatgtttgaaacctagg-----tgtaacgaa---
A0A6Q2Y9Q3_MCL1-01      agaagagtttactg--gatgtttgaaacctagg-----tgtaacgaa---
A0A6Q2YT18_MCL1-01      aggagactttactg--aacatttgaaacctagg-----tggaacgaa---
A0A6Q2YT18_MCL1-02      aggagactttactg--aacatttgaaacctagg-----tggaacgaa---
A0A6Q2XQM7_MCL1-01      aggagactttactg--aacatttgaaacctagg-----tggaacgaa---
A0A6Q2XQM7_MCL1-02      aggagactttactg--aacatttgaaacctagg-----tggaacgaa---
A0A3P8Y1W8_MCL1-04      aagggactacacag--gactgtctcaacctcgt-----tggaaacaa---
A0A3P8Y1W8_MCL1-05      aagggactacacag--gactgtctcaacctcgt-----tggaaacaa---
A0A3P8Y1W8_MCL1-01      caagatcttcccagacgagccgcccaaccctacgaatgtggaggagaccc
A0A3P8Y1W8_MCL1-02      caagatcttcccagacgagccgcccaaccctacgaatgtggaggagaccc
A0A3P8Y1W8_MCL1-03      caagatcttcccagacgagccgcccaaccctacgaatgtggaggagaccc
                               *   * *   *       ****         ** *    *   

A0A6Q2XXK6_MCL1-01      ---agcaaagct---ctgtcaacaatgaaacgagttgtaaccgaaacatt
A0A6Q2Y9Q3_MCL1-01      ---agcaaagct---ctgtcaacaatgaaacgagttgtaaccgaaacatt
A0A6Q2YT18_MCL1-01      ---agcaaagct---ctgtcaacaatgaaacaagttgtcaccaaatcatt
A0A6Q2YT18_MCL1-02      ---agcaaagct---ctgtcaacaatgaaacaagttgtcaccaaatcatt
A0A6Q2XQM7_MCL1-01      ---agcaaagct---ctgtcaacaatgaaacaagttgtcaccaaatcatt
A0A6Q2XQM7_MCL1-02      ---agcaaagct---ctgtcaacaatgaaacaagttgtcaccaaatcatt
A0A3P8Y1W8_MCL1-04      ---aacaagtct---cttgtgacgatgaaaagagtggtgggcgacgtaat
A0A3P8Y1W8_MCL1-05      ---aacaagtct---cttgtgacgatgaaaagagtggtgggcgacgtaat
A0A3P8Y1W8_MCL1-01      ttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaat
A0A3P8Y1W8_MCL1-02      ttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaat
A0A3P8Y1W8_MCL1-03      ttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaat
                           * **   *    **    **           *            * *

A0A6Q2XXK6_MCL1-01      agacaaacacagatactcctac--------------------aatggtat
A0A6Q2Y9Q3_MCL1-01      agacaaacacagatactcctac--------------------aatggtat
A0A6Q2YT18_MCL1-01      ggacaaacacagatactcatac--------------------aatggtat
A0A6Q2YT18_MCL1-02      ggacaaacacagatactcatac--------------------aatggtat
A0A6Q2XQM7_MCL1-01      ggacaaacacagatactcatac--------------------aatggtat
A0A6Q2XQM7_MCL1-02      ggacaaacacagatactcatac--------------------aatggtat
A0A3P8Y1W8_MCL1-04      agccaagcacacatacgcatac--------------------aagggtat
A0A3P8Y1W8_MCL1-05      agccaagcacacatacgcatac--------------------aagggtat
A0A3P8Y1W8_MCL1-01      aacattaaggacattcccatcccaacgctgaaagagatctttgaggcaat
A0A3P8Y1W8_MCL1-02      aacattaaggacattcccatcccaacgctgaaagagatctttgaggcaat
A0A3P8Y1W8_MCL1-03      aacattaaggacattcccatcccaacgctgaaagagatctttgaggcaat
                                  * ** * * * *                     * *  **

A0A6Q2XXK6_MCL1-01      gctctacacactgtccttgga-----tga----------cagcacagggc
A0A6Q2Y9Q3_MCL1-01      gctctacacactgtccttgga-----tga----------cagcacagggc
A0A6Q2YT18_MCL1-01      gctctacagactgtccttggg-----tga----------cagcccagggg
A0A6Q2YT18_MCL1-02      gctctacagactgtccttggg-----tga----------cagcccagggg
A0A6Q2XQM7_MCL1-01      gctctacagactgtccttggg-----tga----------cagcccagggg
A0A6Q2XQM7_MCL1-02      gctctacagactgtccttggg-----tga----------cagcccagggg
A0A3P8Y1W8_MCL1-04      gatctccaaactttgcttgga-----tgatca-------------agggg
A0A3P8Y1W8_MCL1-05      gatctccaaactttgcttgga-----tgatca-------------agggg
A0A3P8Y1W8_MCL1-01      gaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagca
A0A3P8Y1W8_MCL1-02      gaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagca
A0A3P8Y1W8_MCL1-03      gaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagca
                        *     **       * ***      ***                  *  

A0A6Q2XXK6_MCL1-01      atgac---gtgggattcgtgggtgtagttgctaacaggctcttcgcagat
A0A6Q2Y9Q3_MCL1-01      atgac---gtgggattcgtgggtgtagttgctaacaggctcttcgcagat
A0A6Q2YT18_MCL1-01      attac---gtgagattcgtgagtgtaatcgctaacaggctcttcgcagat
A0A6Q2YT18_MCL1-02      attac---gtgagattcgtgagtgtaatcgctaacaggctcttcgcagat
A0A6Q2XQM7_MCL1-01      attac---gtgagattcgtgagtgtaatcgctaacaggctcttcgcagat
A0A6Q2XQM7_MCL1-02      attac---gtgagattcgtgagtgtaatcgctaacaggctcttcgcagat
A0A3P8Y1W8_MCL1-04      atgac---atgggtttcatcacgtctgtggccaagagtctgttcagtgat
A0A3P8Y1W8_MCL1-05      atgac---atgggtttcatcacgtctgtggccaagagtctgttcagtgat
A0A3P8Y1W8_MCL1-01      atgaccctgtggcctttg------ctgttgctgaga---tgctccaggag
A0A3P8Y1W8_MCL1-02      atgaccctgtggcctttg------ctgttgctgaga---tgctccaggag
A0A3P8Y1W8_MCL1-03      atgaccctgtggcctttg------ctgttgctgaga---tgctccaggag
                        ** **    **   **           * **  * *   *  **   ** 

A0A6Q2XXK6_MCL1-01      ggggtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgc
A0A6Q2Y9Q3_MCL1-01      ggggtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgc
A0A6Q2YT18_MCL1-01      gggaccacaaactggggccgcgttatcagcctgctcgcgttcgggactgt
A0A6Q2YT18_MCL1-02      gggaccacaaactggggccgcgttatcagcctgctcgcgttcgggactgt
A0A6Q2XQM7_MCL1-01      gggaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgt
A0A6Q2XQM7_MCL1-02      gggaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgt
A0A3P8Y1W8_MCL1-04      gggactacaaactggggtcgcattgccagcttggtgggctttggggcagt
A0A3P8Y1W8_MCL1-05      gggactacaaactggggtcgcattgccagcttggtgggctttggggcagt
A0A3P8Y1W8_MCL1-01      aacaccactctgcagagtc---ttaacatcgagtcgaacttc--atcacc
A0A3P8Y1W8_MCL1-02      aacaccactctgcagagtc---ttaacatcgagtcgaacttc--atcacc
A0A3P8Y1W8_MCL1-03      aacaccactctgcagagtc---ttaacatcgagtcgaacttc--atcacc
                              **      * * *   **   * *  *      **     *   

A0A6Q2XXK6_MCL1-01      ggtgtgccggtacctcaaggataagggcaaagagaactgtgtggaagcgg
A0A6Q2Y9Q3_MCL1-01      ggtgtgccggtacctcaaggataagggcaaagagaactgtgtggaagcgg
A0A6Q2YT18_MCL1-01      ggtgtgccggtacctcaaggataagggcaaagacaactgtgtggaagcgg
A0A6Q2YT18_MCL1-02      ggtgtgccggtacctcaaggataagggcaaagacaactgtgtggaagcgg
A0A6Q2XQM7_MCL1-01      ggtgtgccggtacctcaaggataagggcaaagacaactgtgtggaagcgg
A0A6Q2XQM7_MCL1-02      ggtgtgccggtacctcaaggataagggcaaagacaactgtgtggaagcgg
A0A3P8Y1W8_MCL1-04      agtgagtcaacacctgaaggagatgggcaagggaaactgcgttgagttgg
A0A3P8Y1W8_MCL1-05      agtgagtcaacacctgaaggagatgggcaagggaaactgcgttgagttgg
A0A3P8Y1W8_MCL1-01      agtgagg----gcatgacggccattgtcaaggcca---------------
A0A3P8Y1W8_MCL1-02      agtgagg----gcatgacggccattgtcaaggcca---------------
A0A3P8Y1W8_MCL1-03      agtgagg----gcatgacggccattgtcaaggcca---------------
                         *** *      * * * **  *  * *** *  *               

A0A6Q2XXK6_MCL1-01      tgggacaagagatctccatgcacctactgaccgaccataaagactggctg
A0A6Q2Y9Q3_MCL1-01      tgggacaagagatctccatgcacctactgaccgaccataaagactggctg
A0A6Q2YT18_MCL1-01      tgggacaggagatctccatgtacctactgacagaccagagagactggctg
A0A6Q2YT18_MCL1-02      tgggacaggagatctccatgtacctactgacagaccagagagactggctg
A0A6Q2XQM7_MCL1-01      tgggacaggagatctccatgtacctactgacagaccagagagactggctg
A0A6Q2XQM7_MCL1-02      tgggacaggagatctccatgtacctactgacagaccagagagactggctg
A0A3P8Y1W8_MCL1-04      ttggccaagaaatctccacatacctcctcactgaccaaagggcctggctc
A0A3P8Y1W8_MCL1-05      ttggccaagaaatctccacatacctcctcactgaccaaagggcctggctc
A0A3P8Y1W8_MCL1-01      -tggccaacaa----caata--------cactgaccga--gatcaagatc
A0A3P8Y1W8_MCL1-02      -tggccaacaa----caata--------cactgaccga--gatcaagatc
A0A3P8Y1W8_MCL1-03      -tggccaacaa----caata--------cactgaccga--gatcaagatc
                          ** **  *     * *           ** ****       *  * * 

A0A6Q2XXK6_MCL1-01      g----tcaaaaaca-actcatggga-----cg-gattcgtcgagttcttt
A0A6Q2Y9Q3_MCL1-01      g----tcaaaaaca-actcatggga-----cg-gattcgtcgagttcttt
A0A6Q2YT18_MCL1-01      g----taaaaaaca-actcctggga-----cg-gattcgtggagttcttt
A0A6Q2YT18_MCL1-02      g----taaaaaaca-actcctggga-----cg-gattcgtggagttcttt
A0A6Q2XQM7_MCL1-01      g----taaaaaaca-actcctggga-----cg-gattcgtggagttcttt
A0A6Q2XQM7_MCL1-02      g----taaaaaaca-actcctggga-----cg-gattcgtggagttcttt
A0A3P8Y1W8_MCL1-04      g----tgaaaaaca-acgcttggga-----tg-gatttgtagagtttttt
A0A3P8Y1W8_MCL1-05      g----tgaaaaaca-acgcttggga-----tg-gatttgtagagtttttt
A0A3P8Y1W8_MCL1-01      gacaatcagagacagaagctcggggactcctgcgaaatggagattgccag
A0A3P8Y1W8_MCL1-02      gacaatcagagacagaagctcggggactcctgcgaaatggagattgccag
A0A3P8Y1W8_MCL1-03      gacaatcagagacagaagctcggggactcctgcgaaatggagattgccag
                        *    * * * *** *  *  ***       * **   *  ** *     

A0A6Q2XXK6_MCL1-01      cgggtagcaga--------ggagtctacattgagaaacg----tactcgt
A0A6Q2Y9Q3_MCL1-01      cgggtagcaga--------ggagtctacattgagaaacg----tactcgt
A0A6Q2YT18_MCL1-01      cgggtagcaga--------ggagtctacattgagaaacg----tactcct
A0A6Q2YT18_MCL1-02      cgggtagcaga--------ggagtctacattgagaaacg----tactcct
A0A6Q2XQM7_MCL1-01      cgggtagcaga--------ggagtctacattgagaaacg----tactcct
A0A6Q2XQM7_MCL1-02      cgggtagcaga--------ggagtctacattgagaaacg----tactcct
A0A3P8Y1W8_MCL1-04      catgtagaaga-----tccagagtcctcagtaaggaacaccctt------
A0A3P8Y1W8_MCL1-05      catgtagaaga-----tccagagtcctcagtaaggaacaccctt------
A0A3P8Y1W8_MCL1-01      catgttggagaacaactccagcatcctaaagatcggctaccacttcaccc
A0A3P8Y1W8_MCL1-02      catgttggagaacaactccagcatcctaaagatcggctaccacttcaccc
A0A3P8Y1W8_MCL1-03      catgttggagaacaactccagcatcctaaagatcggctaccacttcaccc
                        *  ** * ***         *  **   *              *      

A0A6Q2XXK6_MCL1-01      aacatttgctgcat-------------ttgctggcttttgggcagcgctg
A0A6Q2Y9Q3_MCL1-01      aacatttgctgcat-------------ttgctgtgtcaatggta-cact-
A0A6Q2YT18_MCL1-01      aa---------cat-------------ttg--------------------
A0A6Q2YT18_MCL1-02      aa---------cat-------------ttgctggcttcagggcagcgctg
A0A6Q2XQM7_MCL1-01      aa---------cat-------------ttgctggcttcggggcagcgctg
A0A6Q2XQM7_MCL1-02      aa---------cat-------------ttgctggcttcggggcagcgctg
A0A3P8Y1W8_MCL1-04      ----atggcctt-tgcaggag------ttgctggaattggggcaacactt
A0A3P8Y1W8_MCL1-05      ----atggcctt-tgcaggag------ttgctggaattggggcaacactt
A0A3P8Y1W8_MCL1-01      agcaagggcctcgtgccagagcagccatcgccatcaccagg--aacaatg
A0A3P8Y1W8_MCL1-02      agcaagggcctcgtgccagagcagccatcgccatcaccagg--aacaatg
A0A3P8Y1W8_MCL1-03      agcaagggcctcgtgccagagcagccatcgccatcaccagg--aacaatg
                                     *             * *                    

A0A6Q2XXK6_MCL1-01      gtcatgttggacatg-----------------------------------
A0A6Q2Y9Q3_MCL1-01      ---atattagggctgtgtac------------------------------
A0A6Q2YT18_MCL1-01      ---atgtagtata-------------------------------cactct
A0A6Q2YT18_MCL1-02      gccatgttgaaaatgtatgt---------------------ggtcactgg
A0A6Q2XQM7_MCL1-01      gccatgttgaaaa------t---------------------ggtcg----
A0A6Q2XQM7_MCL1-02      gccatgttgaaaatgtatgt---------------------ggtcactgg
A0A3P8Y1W8_MCL1-04      gccctgttaatcagacagagtcctgctcacccctggggttgtgaggcgtg
A0A3P8Y1W8_MCL1-05      gccctgttaatcag------------------------------------
A0A3P8Y1W8_MCL1-01      acctgatt---cgtcaacag------------------------------
A0A3P8Y1W8_MCL1-02      acctgattg----tctatggttttcctacatgcgatgatctgtcacatag
A0A3P8Y1W8_MCL1-03      acctgagtgagcatctatag------------------------------
                                                                          

A0A6Q2XXK6_MCL1-01      ----------------taa
A0A6Q2Y9Q3_MCL1-01      ----------------tga
A0A6Q2YT18_MCL1-01      gtggatccgtttttcttag
A0A6Q2YT18_MCL1-02      aaagaatttgtacatgtag
A0A6Q2XQM7_MCL1-01      --------ggtaccaatag
A0A6Q2XQM7_MCL1-02      aaagagtttgtacatgtag
A0A3P8Y1W8_MCL1-04      tttgtgtgaccctagctag
A0A3P8Y1W8_MCL1-05      -----gtga----------
A0A3P8Y1W8_MCL1-01      -------aggctaagatga
A0A3P8Y1W8_MCL1-02      gcgtttcagtttcacatga
A0A3P8Y1W8_MCL1-03      -------------------
                                           

© 1998-2022Legal notice