Dataset for CDS Unclassified of Organism Anolis carolinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A803U154_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis (length=255 residues).
atggagattaatatcagagctgtgactcaggttggccgccagcttgcattaattggggatgagtataacagggcatacac
tggcaaaatggaagagtctctttttcatctcaccaaaagggtagcagccaatgtttttcagagttgtttttggaacagct
ttaaaagagttatggaaagtttgggaagtttcttgaaaagtggctggaaaaagaagaccaaccatatttcggtaaattta
ttttactctgcataa
© 1998-2023Legal notice