Dataset for CDS BCL-2-like of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9BIG9_BCL2L1-      atgtcggacagt---aacagagagctggtcgagttcttcatcggc-----
A0A2U9BY16_BCL2L1-      atgtct--cag----aacaaagaactggtggttttctacatacag-----
A0A2U9BY16_BCL2L1-      atgtct--cag----aacaaagaactggtggttttctacatacag-----
A0A2U9BY16_BCL2L1-      atgtct--cag----aacaaagaactggtggttttctacatacag-----
A0A2U9BY16_BCL2L1-      atgtct--cag----aacaaagaactggtggttttctacatacag-----
A0A2U9BY16_BCL2L1-      --gacg--cca----gacaacgattttgtggagaacaccattcaaggcct
A0A2U9BJ09_BCL2-01      atggcgagcgagtgtaatcgcaatattgtggaaaagtacatctgc-----
A0A2U9CJ81_MCL1-01      atg------------aatatcattccttccacaaagcg-ggccgc-----
                          *             *                                 

A0A2U9BIG9_BCL2L1-      ---------tataagctgtcccagagg-----------------aactac
A0A2U9BY16_BCL2L1-      ---------tataaactctcccagagg-----------------aaatat
A0A2U9BY16_BCL2L1-      ---------tataaactctcccagagg-----------------aaatat
A0A2U9BY16_BCL2L1-      ---------tataaactctcccagagg-----------------aaatat
A0A2U9BY16_BCL2L1-      ---------tataaactctcccagagg-----------------aaatat
A0A2U9BY16_BCL2L1-      gagtggattcgtcagcttttctgtaggtttggctttcacccccaaagtct
A0A2U9BJ09_BCL2-01      ---------cataaactctccaagcgg-----------------ggctac
A0A2U9CJ81_MCL1-01      ---------cttcaacgttacgaccgg-----------------agtcat
                                   * * *  * *    **                       

A0A2U9BIG9_BCL2L1-      ccgacctctct--------------------------------ac----t
A0A2U9BY16_BCL2L1-      ----cctctca--------------------------------accatat
A0A2U9BY16_BCL2L1-      ----cctctca--------------------------------accatat
A0A2U9BY16_BCL2L1-      ----cctctca--------------------------------accatat
A0A2U9BY16_BCL2L1-      ----cctctca--------------------------------accatat
A0A2U9BY16_BCL2L1-      ----cctctgg--------------------------------atatcag
A0A2U9BJ09_BCL2-01      gtgt------------------------------gggggtttgatgatgt
A0A2U9CJ81_MCL1-01      gggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcact
                                                                   *      

A0A2U9BIG9_BCL2L1-      gaggccggaggatgctggtggaag--------------------------
A0A2U9BY16_BCL2L1-      gggacttaatgagcctccgaacag--------------------------
A0A2U9BY16_BCL2L1-      gggacttaatgagcctccgaacag--------------------------
A0A2U9BY16_BCL2L1-      gggacttaatgagcctccgaacag--------------------------
A0A2U9BY16_BCL2L1-      gggacttaatgagcctccgaacag--------------------------
A0A2U9BY16_BCL2L1-      ctgacc--atggttgtctgaacagaggaaagcagggagacagcctggcac
A0A2U9BJ09_BCL2-01      ccgagatgaagatgccgctgataa------------------------cg
A0A2U9CJ81_MCL1-01      acg-gctcaggaaattccttgccg------------------------ca
                          *     * *                                       

A0A2U9BIG9_BCL2L1-      ----------------------gact--gagggagacaaggccaact---
A0A2U9BY16_BCL2L1-      ----------------------gact--gatcggggggaggcaggtttgg
A0A2U9BY16_BCL2L1-      ----------------------gact--gatcggggggaggcaggtttgg
A0A2U9BY16_BCL2L1-      ----------------------gact--gatcggggggaggcaggtttgg
A0A2U9BY16_BCL2L1-      ----------------------gact--gatcggggggaggcaggtttgg
A0A2U9BY16_BCL2L1-      agcgagcattcactctaacacagact--gatcggggggaggcaggtttgg
A0A2U9BJ09_BCL2-01      ggtcgatagttgcccctccaccgactct-------ggtgcgccggtgcca
A0A2U9CJ81_MCL1-01      gatcgccgtgggctccgtgatcgactcccgcggcgggaacgtcggcgccg
                                              ****              *         

A0A2U9BIG9_BCL2L1-      --------cagctgccagcaatggcttgttggt------cgacgg--cgg
A0A2U9BY16_BCL2L1-      gggaggaacagcagacagcgccgcat-----gc------caacggaactc
A0A2U9BY16_BCL2L1-      gggaggaacagcagacagcgccgcat-----gc------caacggaactc
A0A2U9BY16_BCL2L1-      gggaggaacagcagacagcgccgcat-----gc------caacggaactc
A0A2U9BY16_BCL2L1-      gggaggaacagcagacagcgccgcat-----gc------caacggaactc
A0A2U9BY16_BCL2L1-      gggaggaacagcagacagcgccgcat-----gc------caacggaactc
A0A2U9BJ09_BCL2-01      tgga--gccagcaccgggcc-------------------cgacga-----
A0A2U9CJ81_MCL1-01      gggacgccccgaagcggcccaagaacctccaggtctccgcaacgaaggcg
                                * *       *                    * ***      

A0A2U9BIG9_BCL2L1-      caacagg-tgcggtcagctgggg-----------------actgacccgt
A0A2U9BY16_BCL2L1-      taaacgg-cgtga--atcccggg-----------------acccccccag
A0A2U9BY16_BCL2L1-      taaacgg-cgtga--atcccggg-----------------acccccccag
A0A2U9BY16_BCL2L1-      taaacgg-cgtga--atcccggg-----------------acccccccag
A0A2U9BY16_BCL2L1-      taaacgg-cgtga--atcccggg-----------------acccccccag
A0A2U9BY16_BCL2L1-      taaacgg-cgtga--atcccggg-----------------acccccccag
A0A2U9BJ09_BCL2-01      --------cgagagccaccccga-----------------cctctgtagg
A0A2U9CJ81_MCL1-01      tacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcgg
                                   *     *   *                   *        

A0A2U9BIG9_BCL2L1-      tgcccccg----------gacggt--------------ggc---------
A0A2U9BY16_BCL2L1-      agtccccactgcggctgcaacggttgccttcatcgccgagc---------
A0A2U9BY16_BCL2L1-      agtccccactgcggctgcaacggttgccttcatcgccgagc---------
A0A2U9BY16_BCL2L1-      agtccccactgcggctgcaacggttgccttcatcgccgagc---------
A0A2U9BY16_BCL2L1-      agtccccactgcggctgcaacggttgccttcatcgccgagc---------
A0A2U9BY16_BCL2L1-      agtccccactgcggctgcaacggttgccttcatcgccgagc---------
A0A2U9BJ09_BCL2-01      cggccgc-ctcagtc--------------cgagccgcgcgc-cgccgtcc
A0A2U9CJ81_MCL1-01      cggcggctctctgccctccaccccggagtcggacggcgagcacgacgtct
                         * *  *                                **         

A0A2U9BIG9_BCL2L1-      -gtgg-----gggctgtgaaggaggcgctcagggactccgctcatgagtt
A0A2U9BY16_BCL2L1-      -ctgg-----atgcagtaaaagaggcccttcgggactcggccaacgagtt
A0A2U9BY16_BCL2L1-      -ctgg-----atgcagtaaaagaggcccttcgggactcggccaacgagtt
A0A2U9BY16_BCL2L1-      -ctgg-----atgcagtaaaagaggcccttcgggactcggccaacgagtt
A0A2U9BY16_BCL2L1-      -ctgg-----atgcagtaaaagaggcccttcgggactcggccaacgagtt
A0A2U9BY16_BCL2L1-      -ctgg-----atgcagtaaaagaggcccttcgggactcggccaacgagtt
A0A2U9BJ09_BCL2-01      accgg--gtcctgcg-----cgaggcgggcgac------------gaact
A0A2U9CJ81_MCL1-01      -ccggttgtccggcggcggacgaggcgctggacagcttcaccagggaact
                           **       **       *****                   **  *

A0A2U9BIG9_BCL2L1-      --------------tgaacagctcttcaaccaagcgttcagtgacctctc
A0A2U9BY16_BCL2L1-      --------------tgagctgcggtacgcgcgcgccttcagcgatctgca
A0A2U9BY16_BCL2L1-      --------------tgagctgcggtacgcgcgcgccttcagcgatctgca
A0A2U9BY16_BCL2L1-      --------------tgagctgcggtacgcgcgcgccttcagcgatctgca
A0A2U9BY16_BCL2L1-      --------------tgagctgcggtacgcgcgcgccttcagcgatctgca
A0A2U9BY16_BCL2L1-      --------------tgagctgcggtacgcgcgcgccttcagcgatctgca
A0A2U9BJ09_BCL2-01      --------------tgagagactgtaccagccggacttcacggagatgtc
A0A2U9CJ81_MCL1-01      cattagccagttcctgagagactatgtcgcgcgcacggacccgcggtgga
                                      ***    *  *                 *   *   

A0A2U9BIG9_BCL2L1-      cctgcagctcgacatcacccctgacacg----------------------
A0A2U9BY16_BCL2L1-      caaccagctgcacatcacgccggccacg----------------------
A0A2U9BY16_BCL2L1-      caaccagctgcacatcacgccggccacg----------------------
A0A2U9BY16_BCL2L1-      caaccagctgcacatcacgccggccacg----------------------
A0A2U9BY16_BCL2L1-      caaccagctgcacatcacgccggccacg----------------------
A0A2U9BY16_BCL2L1-      caaccagctgcacatcacgccggccacg----------------------
A0A2U9BJ09_BCL2-01      gcggcagctgtacctcacctccaccacg----------------------
A0A2U9CJ81_MCL1-01      ccgacagcaaagcgctg--tccacgatgaagagagtggtggaccgactgg
                            ****    *       *    * *                      

A0A2U9BIG9_BCL2L1-      -------gcctaccaaagc-tttaagagtgtgatggacgaggtgttca--
A0A2U9BY16_BCL2L1-      -------gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc--
A0A2U9BY16_BCL2L1-      -------gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc--
A0A2U9BY16_BCL2L1-      -------gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc--
A0A2U9BY16_BCL2L1-      -------gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc--
A0A2U9BY16_BCL2L1-      -------gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc--
A0A2U9BJ09_BCL2-01      -------gcgcagaggcgc-ttcgccgaggtgatcgacgaactgttcc--
A0A2U9CJ81_MCL1-01      tggagaagcacagatacgcatacaacggtatgatgaatagactgtccttg
                               **  *     ** *         ****  *     *** *   

A0A2U9BIG9_BCL2L1-      ----------aggacggagtc-----------------------------
A0A2U9BY16_BCL2L1-      ----------gggacggcgtc-----------------------------
A0A2U9BY16_BCL2L1-      ----------gggacggcgtc-----------------------------
A0A2U9BY16_BCL2L1-      ----------gggacggcgtc-----------------------------
A0A2U9BY16_BCL2L1-      ----------gggacggcgtc-----------------------------
A0A2U9BY16_BCL2L1-      ----------gggacggcgtc-----------------------------
A0A2U9BJ09_BCL2-01      ----------gggacggggtg-----------------------------
A0A2U9CJ81_MCL1-01      gacaacagaagggacgatgtgacgtttgtcggcgccgtagccaggagcct
                                   *****  **                              

A0A2U9BIG9_BCL2L1-      -------------------aactggggacgtatagtgggcctgttcgctt
A0A2U9BY16_BCL2L1-      -------------------aactggggccgcatcatagggctttttgcat
A0A2U9BY16_BCL2L1-      -------------------aactggggccgcatcatagggctttttgcat
A0A2U9BY16_BCL2L1-      -------------------aactggggccgcatcatagggctttttgcat
A0A2U9BY16_BCL2L1-      -------------------aactggggccgcatcatagggctttttgcat
A0A2U9BY16_BCL2L1-      -------------------aactggggccgcatcatagggctttttgcat
A0A2U9BJ09_BCL2-01      -------------------aactggggccggattatcgcgttcttcgagt
A0A2U9CJ81_MCL1-01      cttcggggacggcaacacaaactggggccgcgtctccagcctggtggcgt
                                           ******** **  *        *  * *  *

A0A2U9BIG9_BCL2L1-      ttggcggcgtgctgtgtgtggaatgcgtcga-----gaagaataggggcg
A0A2U9BY16_BCL2L1-      ttggcggggcgctgagtgtggagtgtgtgga-----gaaggagatgagtt
A0A2U9BY16_BCL2L1-      ttggcggggcgctgagtgtggagtgtgtgga-----gaaggagatgagtt
A0A2U9BY16_BCL2L1-      ttggcggggcgctgagtgtggagtgtgtgga-----gaaggagatgagtt
A0A2U9BY16_BCL2L1-      ttggcggggcgctgagtgtggagtgtgtgga-----gaaggagatgagtt
A0A2U9BY16_BCL2L1-      ttggcggggcgctgagtgtggagtgtgtgga-----gaaggagatgagtt
A0A2U9BJ09_BCL2-01      tcgggggcaccgtgtgcgtggagtgcgccgacacc--gaggagatgacat
A0A2U9CJ81_MCL1-01      tcgggg---ccgtg--------gtgagtcagcacctgaaggagacgg---
                        * ** *      **         ** *           ** * * *    

A0A2U9BIG9_BCL2L1-      agctggtcgcccgtatcgctgactggat--gaccatgtacctggatgagc
A0A2U9BY16_BCL2L1-      cgctggtgggcaggatcgttgagtggat--gacggtgtacctagacaaca
A0A2U9BY16_BCL2L1-      cgctggtgggcaggatcgttgagtggat--gacggtgtacctagacaaca
A0A2U9BY16_BCL2L1-      cgctggtgggcaggatcgttgagtggat--gacggtgtacctagacaaca
A0A2U9BY16_BCL2L1-      cgctggtgggcaggatcgttgagtggat--gacggtgtacctagacaaca
A0A2U9BY16_BCL2L1-      cgctggtgggcaggatcgttgagtggat--gacggtgtacctagacaaca
A0A2U9BJ09_BCL2-01      cgcaggtggacaacatcgcggagtggat--gacagagtatttaaatggac
A0A2U9CJ81_MCL1-01      -gcaggggg--aactgcgtggagctcgtcgggcaggagatctccacatac
                         ** **  *       **  **     *  * *     *  *  *     

A0A2U9BIG9_BCL2L1-      acatcagccc----------ctggatccagagccaaggaggctggg----
A0A2U9BY16_BCL2L1-      acatccagcc----------ctggatccaaagtcaaggaggatggacttt
A0A2U9BY16_BCL2L1-      acatccagcc----------ctggatccaaagtcaaggaggatggg----
A0A2U9BY16_BCL2L1-      acatccagcc----------ctggatccaaagtcaaggaggatggg----
A0A2U9BY16_BCL2L1-      acatccagcc----------ctggatccaaagtcaaggaggatggg----
A0A2U9BY16_BCL2L1-      acatccagcc----------ctggatccaaagtcaaggaggatggg----
A0A2U9BJ09_BCL2-01      cgcttaacag----------ctggattatggacaacgggggatggg----
A0A2U9CJ81_MCL1-01      ctgctgacggaccagcgagactggctggtgaaaaacaactcctggg----
                                            **** *        *       ***     

A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      ttgccaccagaccaccaggccagtcaagcccagaaagatgaagatgcccc
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
                                                                          

A0A2U9BIG9_BCL2L1-      ------------gctgctttgcgga---------gatttttgggcaag--
A0A2U9BY16_BCL2L1-      ccaggacggtcttccactctgctgacggctcctgcatctctgggaaggtc
A0A2U9BY16_BCL2L1-      --ag----------cactttgctga---------aatcttcgggcagg--
A0A2U9BY16_BCL2L1-      --ag----------cactttgctga---------aatcttcgggcagg--
A0A2U9BY16_BCL2L1-      --ag----------cactttgctga---------aatcttcgggcagg--
A0A2U9BY16_BCL2L1-      --ag----------cactttgctga---------aatcttcgggcagg--
A0A2U9BJ09_BCL2-01      ------------acgccttcgtgga---------gctgtac-----ga--
A0A2U9CJ81_MCL1-01      ------------agggctttgtgga---------atttttccgagtag--
                                        **  *  **           * *           

A0A2U9BIG9_BCL2L1-      -------------------gcgccggcgcagaagcaa--------ggaga
A0A2U9BY16_BCL2L1-      tggcagaacttgagtcggtacactgcagcag---gtc--------aaag-
A0A2U9BY16_BCL2L1-      -------------------acgcggcggcagggagtc--------gaagg
A0A2U9BY16_BCL2L1-      -------------------acgcggcggcagggagtc--------gaagg
A0A2U9BY16_BCL2L1-      -------------------acgcggcggcagggagtc--------gaagg
A0A2U9BY16_BCL2L1-      -------------------acgcggcggcagggagtc--------gaagg
A0A2U9BJ09_BCL2-01      ----------------------cagacacggggagtccgtcttcagctgc
A0A2U9CJ81_MCL1-01      ----------------------cagacccagaga----------------
                                              * *   * *                   

A0A2U9BIG9_BCL2L1-      tatcgggagagcgtgaggcg-atggctgctagttggagtgggga------
A0A2U9BY16_BCL2L1-      ----aggagaaaaacaggaaggtgtacagtgtcatggatgcaacaggctc
A0A2U9BY16_BCL2L1-      tctcaggagagtttcaagaa-gtggctgctggcagggatg----------
A0A2U9BY16_BCL2L1-      tctcaggagagtttcaagaa-gtggctgctggcagggatg----------
A0A2U9BY16_BCL2L1-      tctcaggagagtttcaagaa-gtggctgctggcagggatg----------
A0A2U9BY16_BCL2L1-      tctcaggagagtttcaagaa-gtggctgctggcagggatg----------
A0A2U9BJ09_BCL2-01      tcctggccctccatcaagaccg---tcttcggcctggctgcactcg----
A0A2U9CJ81_MCL1-01      -------cgacaatgaggaacacactgattggccttgctggatttg----
                                       * *                    **          

A0A2U9BIG9_BCL2L1-      -------------------tgctgacaggagtgctgattgctatgtt---
A0A2U9BY16_BCL2L1-      acccacccccctcctctctctgtggtctgtgttgtggcaggatccctttc
A0A2U9BY16_BCL2L1-      ----accc-----------tggtgaccggggtcgtggtgggctcact---
A0A2U9BY16_BCL2L1-      ----accc-----------tggtgaccggggtcgtggtgggctcact---
A0A2U9BY16_BCL2L1-      ----accc-----------tggtgaccggggtcgtggtgggctcact---
A0A2U9BY16_BCL2L1-      ----accc-----------tggtgaccggggtcgtggtgggctcact---
A0A2U9BJ09_BCL2-01      -------------------gggcggcgagcctcaccatcggagcgta---
A0A2U9CJ81_MCL1-01      -------------------ctggtg------------ttggggcgac---
                                                               *          

A0A2U9BIG9_BCL2L1-      ----catcgctaagaaacag--------tga
A0A2U9BY16_BCL2L1-      cctaattttctccactgcacgtggtatttaa
A0A2U9BY16_BCL2L1-      ----gattgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      ----gattgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      ----gattgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      ----gattgcccagaagcgcctg-----tga
A0A2U9BJ09_BCL2-01      ----cctcacgcag------aag-----tga
A0A2U9CJ81_MCL1-01      ----actggccctgttgatcagg-----tga
                              *  *                  * *

© 1998-2020Legal notice