Dataset for CDS BCL-2-like of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8D3DY18_BCL2L10      --------------------------------------------------
A0A2U9CJ81_MCL1-01      atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccgg
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
                                                                          

A0A8D3CTR5_BCL2L1-      ----atgtcg----------------------gacagtaacagagagctg
A0A2U9BJ09_BCL2-01      ----atggcgagc-------------------gagtgtaatcgcaatatt
A0A8D3DY18_BCL2L10      ----atgtcctgt-------------------ggg-------------ct
A0A2U9CJ81_MCL1-01      agtcatgggctgcctcattcttcctcaaaatggag-------------tc
A0A8D3B2J3_MCL1-05      ----atgggctgcctcattcttcctcaaaatggag-------------tc
A0A8D3B2J3_MCL1-03      ----atgggctgcctcattcttcctcaaaatggag-------------tc
A0A8D3B2J3_MCL1-04      ----atgggctgcctcattcttcctcaaaatggag-------------tc
A0A8D3B2J3_MCL1-01      ----atgggctgcctcattcttcctcaaaatggag-------------tc
A0A8D3B2J3_MCL1-02      ----atgggctgcctcattcttcctcaaaatggag-------------tc
                            ***                         *                 

A0A8D3CTR5_BCL2L1-      gtcgagttct------tcatcggctataagctgtcccaga----------
A0A2U9BJ09_BCL2-01      gtggaaaagt------acatctgccataaactctccaagc----------
A0A8D3DY18_BCL2L10      gtggaaagag------accctggctctg--------------------gc
A0A2U9CJ81_MCL1-01      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
A0A8D3B2J3_MCL1-05      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
A0A8D3B2J3_MCL1-03      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
A0A8D3B2J3_MCL1-04      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
A0A8D3B2J3_MCL1-01      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
A0A8D3B2J3_MCL1-02      gtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgc
                        ** **            *    **                          

A0A8D3CTR5_BCL2L1-      --ggaactacccga----cctctctactgaggccg--------gaggatg
A0A2U9BJ09_BCL2-01      --ggggctacgtgtgggggtt------tgatgatgtccgagatgaagatg
A0A8D3DY18_BCL2L10      ggaggactacctgtc---cctctgctgcaaga-----------------g
A0A2U9CJ81_MCL1-01      cgtgggctccgtgatcgactcccgcggcgggaacgtcggcgccggggacg
A0A8D3B2J3_MCL1-05      cgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacg
A0A8D3B2J3_MCL1-03      cgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacg
A0A8D3B2J3_MCL1-04      cgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacg
A0A8D3B2J3_MCL1-01      cgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacg
A0A8D3B2J3_MCL1-02      cgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacg
                           *  ** *  *                                    *

A0A8D3CTR5_BCL2L1-      ctggtg--gaaggactgagggagacaaggccaactcag------------
A0A2U9BJ09_BCL2-01      ccgctgataacgggtcgatagttgcc---cctccac--------------
A0A8D3DY18_BCL2L10      ccc------gcggcc----agccccctcgcctcc-cagcg-agtcagccg
A0A2U9CJ81_MCL1-01      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
A0A8D3B2J3_MCL1-05      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
A0A8D3B2J3_MCL1-03      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
A0A8D3B2J3_MCL1-04      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
A0A8D3B2J3_MCL1-01      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
A0A8D3B2J3_MCL1-02      ccccga--agcggcccaagaacctccaggtctccgcaacgaaggcgtacg
                        *          **           *     *  * *              

A0A8D3CTR5_BCL2L1-      ctgccagcaatggcttgttggtcgacggcggcaacagggactccgctcat
A0A2U9BJ09_BCL2-01      cgactctggtgcgc--------------------cggtgccatggagc--
A0A8D3DY18_BCL2L10      ccgccatgagacgcctggc---------------ccgggacatggaga--
A0A2U9CJ81_MCL1-01      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
A0A8D3B2J3_MCL1-05      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
A0A8D3B2J3_MCL1-03      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
A0A8D3B2J3_MCL1-04      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
A0A8D3B2J3_MCL1-01      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
A0A8D3B2J3_MCL1-02      cggccaagagctgccgggaggacggcggcggcggcggcgacgtcg-gc--
                        *  *        **                    * * * *   *     

A0A8D3CTR5_BCL2L1-      gagtttgaacagctct----------------tcaaccaagcgttcagtg
A0A2U9BJ09_BCL2-01      ---------cagcaccgggcccgacgacgagagccaccccgacctctgta
A0A8D3DY18_BCL2L10      -------agcagcaccaggctc----------gcttccacgcgctcg---
A0A2U9CJ81_MCL1-01      -------ggcggctctctgccc----------tccaccccggagtcggac
A0A8D3B2J3_MCL1-05      -------ggcggctctctgccc----------tccaccccggagtcggac
A0A8D3B2J3_MCL1-03      -------ggcggctctctgccc----------tccaccccggagtcggac
A0A8D3B2J3_MCL1-04      -------ggcggctctctgccc----------tccaccccggagtcggac
A0A8D3B2J3_MCL1-01      -------ggcggctctctgccc----------tccaccccggagtcggac
A0A8D3B2J3_MCL1-02      -------ggcggctctctgccc----------tccaccccggagtcggac
                                 * ** *                  *  **  *   **    

A0A8D3CTR5_BCL2L1-      acctctccctgcagctcga-------------------------------
A0A2U9BJ09_BCL2-01      ggcggccgcctcagtccgagccgcgcgccgccgtccaccgggtc------
A0A8D3DY18_BCL2L10      --------------cccaggccttcctgcggcag-tgcgg-gccggaccc
A0A2U9CJ81_MCL1-01      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
A0A8D3B2J3_MCL1-05      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
A0A8D3B2J3_MCL1-03      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
A0A8D3B2J3_MCL1-04      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
A0A8D3B2J3_MCL1-01      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
A0A8D3B2J3_MCL1-02      ggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacag
                                        *                                 

A0A8D3CTR5_BCL2L1-      catcacc--------------------cctga------------------
A0A2U9BJ09_BCL2-01      ctgcgcgaggcgggcgacgaa------cttgagagactgtaccagccgga
A0A8D3DY18_BCL2L10      ctgcaccag------------------cctcagg----------------
A0A2U9CJ81_MCL1-01      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
A0A8D3B2J3_MCL1-05      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
A0A8D3B2J3_MCL1-03      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
A0A8D3B2J3_MCL1-04      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
A0A8D3B2J3_MCL1-01      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
A0A8D3B2J3_MCL1-02      cttcaccagggaactcattagccagttcctgagagactatgtcgcgcgca
                        *  * *                     * * *                  

A0A8D3CTR5_BCL2L1-      ------cacggc--------------------------------------
A0A2U9BJ09_BCL2-01      c---ttcacgga-------------------------gatgtcgcggcag
A0A8D3DY18_BCL2L10      -------gcggt-------------------------gatggaggagctg
A0A2U9CJ81_MCL1-01      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
A0A8D3B2J3_MCL1-05      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
A0A8D3B2J3_MCL1-03      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
A0A8D3B2J3_MCL1-04      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
A0A8D3B2J3_MCL1-01      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
A0A8D3B2J3_MCL1-02      cggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtg
                                ***                                       

A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A2U9BJ09_BCL2-01      ctgtacct---------------ca-------------------------
A0A8D3DY18_BCL2L10      gcg-----------ggagacggaca-------------------------
A0A2U9CJ81_MCL1-01      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
A0A8D3B2J3_MCL1-05      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
A0A8D3B2J3_MCL1-03      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
A0A8D3B2J3_MCL1-04      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
A0A8D3B2J3_MCL1-01      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
A0A8D3B2J3_MCL1-02      gtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaa
                                                                          

A0A8D3CTR5_BCL2L1-      ---------ct---accaaag------------------------cttta
A0A2U9BJ09_BCL2-01      ---------cctccaccacggcgcag--------------aggcgcttcg
A0A8D3DY18_BCL2L10      ---------cttgaactggggcagggtcatctccattttcaccttcgccg
A0A2U9CJ81_MCL1-01      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
A0A8D3B2J3_MCL1-05      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
A0A8D3B2J3_MCL1-03      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
A0A8D3B2J3_MCL1-04      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
A0A8D3B2J3_MCL1-01      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
A0A8D3B2J3_MCL1-02      tagactgtccttggacaacagaaggg------acgatgtgacgtttgtcg
                                 *    **    *                             

A0A8D3CTR5_BCL2L1-      agagtgtgatggacgaggtgttcaaggacggagt------caactgggga
A0A2U9BJ09_BCL2-01      ccgaggtgatcgacgaactgttccgggacggggt------gaactggggc
A0A8D3DY18_BCL2L10      gggtggtggtcag--gcagctgctggagcaggagggcctgaagccggggc
A0A2U9CJ81_MCL1-01      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
A0A8D3B2J3_MCL1-05      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
A0A8D3B2J3_MCL1-03      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
A0A8D3B2J3_MCL1-04      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
A0A8D3B2J3_MCL1-01      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
A0A8D3B2J3_MCL1-02      gcgccgtagccaggagcctcttcggggacggcaacac---aaactggggc
                             **             * *  *  * *          * * **** 

A0A8D3CTR5_BCL2L1-      cgtatagtgggcctgttcgcttttgg---cggcgtgctgtgtgtggaatg
A0A2U9BJ09_BCL2-01      cggattatcgcgttcttcgagttcgg---gggcaccgtgtgcgtggagtg
A0A8D3DY18_BCL2L10      tg-ga----------ccccgggcaggagctggcacaggggcc-cggg---
A0A2U9CJ81_MCL1-01      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
A0A8D3B2J3_MCL1-05      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
A0A8D3B2J3_MCL1-03      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
A0A8D3B2J3_MCL1-04      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
A0A8D3B2J3_MCL1-01      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
A0A8D3B2J3_MCL1-02      cgcgt----------ctccagcctgg---tggcgttcggggc-cgtggtg
                         *               *      **    ***     *     *     

A0A8D3CTR5_BCL2L1-      cgtc--------gagaaga-------ataggggcgagctggtcgcccgta
A0A2U9BJ09_BCL2-01      cgccgacacc--gaggagatgacatcgcag----------gtggacaaca
A0A8D3DY18_BCL2L10      -------agctgcaggggactg----gcag--------------------
A0A2U9CJ81_MCL1-01      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
A0A8D3B2J3_MCL1-05      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
A0A8D3B2J3_MCL1-03      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
A0A8D3B2J3_MCL1-04      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
A0A8D3B2J3_MCL1-01      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
A0A8D3B2J3_MCL1-02      agtcagcacctgaaggagacgg----gcagggggaactgcgtggagctcg
                                     **  **         **                    

A0A8D3CTR5_BCL2L1-      tcgctgactggatgaccatgtacctg--gatgagcacatcagcccctgga
A0A2U9BJ09_BCL2-01      tcgcggagtggatgacagagtattta--aatggaccgcttaacagctgga
A0A8D3DY18_BCL2L10      ------agaccatagccgattacctgggagaggagaa--gaaggactggc
A0A2U9CJ81_MCL1-01      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
A0A8D3B2J3_MCL1-05      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
A0A8D3B2J3_MCL1-03      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
A0A8D3B2J3_MCL1-04      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
A0A8D3B2J3_MCL1-01      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
A0A8D3B2J3_MCL1-02      tcgggcaggagatctccacatacctgctgacggacca--gcgagactggc
                              *    **  *    **  *      *             **** 

A0A8D3CTR5_BCL2L1-      tccagagccaaggaggctggggctgctttgcggagatttttgggcaaggc
A0A2U9BJ09_BCL2-01      ttatggacaacgggggatgggacgccttcgtggagctgtac---g-----
A0A8D3DY18_BCL2L10      tgctggagaacgatggatgggatgggttctgtaagttctcc---c-----
A0A2U9CJ81_MCL1-01      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
A0A8D3B2J3_MCL1-05      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
A0A8D3B2J3_MCL1-03      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
A0A8D3B2J3_MCL1-04      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
A0A8D3B2J3_MCL1-01      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
A0A8D3B2J3_MCL1-02      tggtgaaaaacaactcctgggagggctttgtggaatttttc---cgagta
                        *   *    *       ****     **     *  * *           

A0A8D3CTR5_BCL2L1-      gccggcgcaga----------------agcaaggagatatcgggagagcg
A0A2U9BJ09_BCL2-01      acagacacggggagtccgtcttcagctgctcctggccctccatcaagacc
A0A8D3DY18_BCL2L10      gcagtgccagaga----------gatgagccaggactcgtcgatgaagac
A0A2U9CJ81_MCL1-01      gcagacccagaga------cgacaatgag---gaacacactgattggcct
A0A8D3B2J3_MCL1-05      gcagacccagaga------cgacaatgag---gaacacactgattggcct
A0A8D3B2J3_MCL1-03      gcagacccagaga------cgacaatgag---gaacacactgattggcct
A0A8D3B2J3_MCL1-04      gcagacccagaga------cgacaatgag---gaacacactgattggcct
A0A8D3B2J3_MCL1-01      gcagacccagaga------cgacaatgag---gaacacactgattggcct
A0A8D3B2J3_MCL1-02      gcagacccagaga------cgacaatgag---gaacacactgattggcct
                         * *   * *                                        

A0A8D3CTR5_BCL2L1-      tgag--gcgatggctgctagttggagtggggatgctgacaggagtgctga
A0A2U9BJ09_BCL2-01      gtcttcggcctggctgca-ctcggggcggcgagcctcaccatcggagcg-
A0A8D3DY18_BCL2L10      ggct--ctgtttgctgct-gctggcgtgggg---cttgccggactcacc-
A0A2U9CJ81_MCL1-01      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
A0A8D3B2J3_MCL1-05      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
A0A8D3B2J3_MCL1-03      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
A0A8D3B2J3_MCL1-04      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
A0A8D3B2J3_MCL1-01      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
A0A8D3B2J3_MCL1-02      tgct--ggatttgctggt-gttggggcgaca---ctggc-----------
                                  * ****      ** * *      **  *           

A0A8D3CTR5_BCL2L1-      ttgctatgttcatcgctaag------------------------------
A0A2U9BJ09_BCL2-01      ------tacctcacgcagaa------------------------------
A0A8D3DY18_BCL2L10      ------ttcctgctggtgcg------------------------------
A0A2U9CJ81_MCL1-01      --------cctgttgatcag------------------------------
A0A8D3B2J3_MCL1-05      --------cctgttgatcagctgcagcagtgcaaatcgtctgttggggct
A0A8D3B2J3_MCL1-03      --------cctgttgatcag------------------------------
A0A8D3B2J3_MCL1-04      --------cctgttgatcag------------------------------
A0A8D3B2J3_MCL1-01      --------cctgttgatcag------------------------------
A0A8D3B2J3_MCL1-02      --------cctgttgatcag------------------------------
                                      *                                   

A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8D3DY18_BCL2L10      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      gcacaaacatgccaacaaattttcagtggatcttgcagcatcagtgaagc
A0A8D3B2J3_MCL1-03      --tgggac----------------tctgactttcgctacatccg------
A0A8D3B2J3_MCL1-04      --ggacacgtgttcatcgctccaaagtgacctccaaccaacaag------
A0A8D3B2J3_MCL1-01      --gaggat------------------------------------------
A0A8D3B2J3_MCL1-02      --g----c------------------------------------------
                                                                          

A0A8D3CTR5_BCL2L1-      --------------------------------------aaacagtga
A0A2U9BJ09_BCL2-01      -------------------------------------------gtga
A0A8D3DY18_BCL2L10      -------------------------------------------ctag
A0A2U9CJ81_MCL1-01      -------------------------------------------gtga
A0A8D3B2J3_MCL1-05      agtgcggcctggaaccccatagcttgcagaaacccttcagcaggtga
A0A8D3B2J3_MCL1-03      -cttctcctccaag--------ctgcgtaaaaaaatgccagcgctga
A0A8D3B2J3_MCL1-04      -gcacattccaaagattttcagtttgcaaaacagaaggatcctctga
A0A8D3B2J3_MCL1-01      ------tgctgagg----------------------------cctga
A0A8D3B2J3_MCL1-02      ------tcctgtgg------------------------------taa
                                                                    *  

© 1998-2023Legal notice