Dataset for CDS BCL-2-like of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9BIG9_BCL2L1-      atgtcggaca---gtaacagagagctggtcgagttcttcatcggctataa
A0A2U9BY16_BCL2L1-      atgtct--ca---g-aacaaagaactggtggttttctacatacagtataa
A0A2U9BJ09_BCL2-01      atggcgagcgagtgtaatcgcaatattgtggaaaagtacatctgccataa
A0A2U9CJ81_MCL1-01      atg------------aatatcattccttccacaaagcg-ggccgccttca
                        ***            **                              * *

A0A2U9BIG9_BCL2L1-      gctgtcccagaggaactacccgacctctct--------------------
A0A2U9BY16_BCL2L1-      actctcccagaggaaatat----cctctca--------------------
A0A2U9BJ09_BCL2-01      actctccaagcggggctacgtgt---------------------------
A0A2U9CJ81_MCL1-01      acgttacgaccggagtcatgggctgcctcattcttcctcaaaatggagtc
                         *  * * *  **    *                                

A0A2U9BIG9_BCL2L1-      ------------ac----tgaggccggaggatgctggtggaagga-----
A0A2U9BY16_BCL2L1-      ------------accatatgggacttaatgagcctccgaacagga-----
A0A2U9BJ09_BCL2-01      ---gggggtttgatgatgtccgagatgaagatgccgctgataacgggtcg
A0A2U9CJ81_MCL1-01      gtggagggagcgatgcactacg-gctcaggaaattccttgccgcagatcg
                                    *     *  *     * **                   

A0A2U9BIG9_BCL2L1-      ---------------------ctgagggagacaaggccaact--------
A0A2U9BY16_BCL2L1-      ---------------------ctgatcggggggaggcaggtttgggggag
A0A2U9BJ09_BCL2-01      atagttgcccctccaccgactct-------ggtgcgccggtgccatgga-
A0A2U9CJ81_MCL1-01      ccgtgggctccgtgatcgactcccgcggcgggaacgtcggcgccggggac
                                             *             *              

A0A2U9BIG9_BCL2L1-      ---cagctgccagcaatggcttgttggt------cgacgg--cggcaaca
A0A2U9BY16_BCL2L1-      gaacagcagacagcgccgcat-----gc------caacggaactctaaac
A0A2U9BJ09_BCL2-01      -gccagcaccgggcc-------------------cgacga----------
A0A2U9CJ81_MCL1-01      gccccgaagcggcccaagaacctccaggtctccgcaacgaaggcgtacgc
                           * *       *                    * ***           

A0A2U9BIG9_BCL2L1-      gg-tgcggtcagctgggg-----------------actgacccgttgccc
A0A2U9BY16_BCL2L1-      gg-cgtga--atcccggg-----------------acccccccagagtcc
A0A2U9BJ09_BCL2-01      ---cgagagccaccccga-----------------cctctgtaggcggcc
A0A2U9CJ81_MCL1-01      ggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcg
                              *     *   *                   *         * * 

A0A2U9BIG9_BCL2L1-      ccg----------gacggt--------------ggc----------gtgg
A0A2U9BY16_BCL2L1-      ccgctgcggctgcaacggttgccttcatcgccgagc----------ctgg
A0A2U9BJ09_BCL2-01      gc-ctcagtc--------------cgagccgcgcgc-cgccgtccaccgg
A0A2U9CJ81_MCL1-01      gctctctgccctccaccccggagtcggacggcgagcacgacgtct-ccgg
                         *                                **            **

A0A2U9BIG9_BCL2L1-      -----gggctgtgaaggaggcgctcagggactccgctcatgagtt-----
A0A2U9BY16_BCL2L1-      -----atgcagtaaaagaggcccttcgggactcggccaacgagtt-----
A0A2U9BJ09_BCL2-01      --gtcctgcg-----cgaggcgggcgac------------gaact-----
A0A2U9CJ81_MCL1-01      ttgtccggcggcggacgaggcgctggacagcttcaccagggaactcatta
                               **       *****                   **  *     

A0A2U9BIG9_BCL2L1-      ---------tgaacagctcttcaaccaagcgttcagtgacctctccctgc
A0A2U9BY16_BCL2L1-      ---------tgagctgcggtacgcgcgcgccttcagcgatctgcacaacc
A0A2U9BJ09_BCL2-01      ---------tgagagactgtaccagccggacttcacggagatgtcgcggc
A0A2U9CJ81_MCL1-01      gccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgac
                                 ***    *  *                 *   *       *

A0A2U9BIG9_BCL2L1-      agctcgacatcacccctgacacg---------------------------
A0A2U9BY16_BCL2L1-      agctgcacatcacgccggccacg---------------------------
A0A2U9BJ09_BCL2-01      agctgtacctcacctccaccacg---------------------------
A0A2U9CJ81_MCL1-01      agcaaagcgctg--tccacgatgaagagagtggtggaccgactggtggag
                        ***    *       *    * *                           

A0A2U9BIG9_BCL2L1-      --gcctaccaaagc-tttaagagtgtgatggacgaggtgttca-------
A0A2U9BY16_BCL2L1-      --gcctaccaaagc-ttcgagagtgtgatgaacgaggtgttcc-------
A0A2U9BJ09_BCL2-01      --gcgcagaggcgc-ttcgccgaggtgatcgacgaactgttcc-------
A0A2U9CJ81_MCL1-01      aagcacagatacgcatacaacggtatgatgaatagactgtccttggacaa
                          **  *     ** *         ****  *     *** *        

A0A2U9BIG9_BCL2L1-      -----aggacggagtc----------------------------------
A0A2U9BY16_BCL2L1-      -----gggacggcgtc----------------------------------
A0A2U9BJ09_BCL2-01      -----gggacggggtg----------------------------------
A0A2U9CJ81_MCL1-01      cagaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcg
                              *****  **                                   

A0A2U9BIG9_BCL2L1-      --------------aactggggacgtatagtgggcctgttcgcttttggc
A0A2U9BY16_BCL2L1-      --------------aactggggccgcatcatagggctttttgcatttggc
A0A2U9BJ09_BCL2-01      --------------aactggggccggattatcgcgttcttcgagttcggg
A0A2U9CJ81_MCL1-01      gggacggcaacacaaactggggccgcgtctccagcctggtggcgttcggg
                                      ******** **  *        *  * *  ** ** 

A0A2U9BIG9_BCL2L1-      ggcgtgctgtgtgtggaatgcgtcga-----gaagaataggggcgagctg
A0A2U9BY16_BCL2L1-      ggggcgctgagtgtggagtgtgtgga-----gaaggagatgagttcgctg
A0A2U9BJ09_BCL2-01      ggcaccgtgtgcgtggagtgcgccgacacc--gaggagatgacatcgcag
A0A2U9CJ81_MCL1-01      g---ccgtg--------gtgagtcagcacctgaaggagacgg----gcag
                        *      **         ** *           ** * * *     ** *

A0A2U9BIG9_BCL2L1-      gtcgcccgtatcgctgactggat--gaccatgtacctggatgagcacatc
A0A2U9BY16_BCL2L1-      gtgggcaggatcgttgagtggat--gacggtgtacctagacaacaacatc
A0A2U9BJ09_BCL2-01      gtggacaacatcgcggagtggat--gacagagtatttaaatggaccgctt
A0A2U9CJ81_MCL1-01      gggg--aactgcgtggagctcgtcgggcaggagatctccacatacctgct
                        *  *       **  **     *  * *     *  *  *          

A0A2U9BIG9_BCL2L1-      agccc----------ctggatccagagccaaggaggctggggctgctttg
A0A2U9BY16_BCL2L1-      cagcc----------ctggatccaaagtcaaggaggatgggagcactttg
A0A2U9BJ09_BCL2-01      aacag----------ctggattatggacaacgggggatgggacgccttcg
A0A2U9CJ81_MCL1-01      gacggaccagcgagactggctggtgaaaaacaactcctgggagggctttg
                                       **** *        *       ****    *** *

A0A2U9BIG9_BCL2L1-      cggagatttttgggcaaggcgccggcgcagaagcaaggagat--------
A0A2U9BY16_BCL2L1-      ctgaaatcttcgggcaggacgcggcggcagggagtcgaaggt--------
A0A2U9BJ09_BCL2-01      tggagctgtac--------gacagacacggggagtccgtcttcagctgct
A0A2U9CJ81_MCL1-01      tggaatttttc---cgagtagcagacccagaga-----------------
                          **  * *            * *   * *                    

A0A2U9BIG9_BCL2L1-      -----------atcgggagagcgtgaggcga--tggctg--ctagttgga
A0A2U9BY16_BCL2L1-      -----------ctcaggagagtttcaagaag--tggctg--ctggcaggg
A0A2U9BJ09_BCL2-01      cctggccctccatcaagaccg---tcttcggcctggctgcactcggggcg
A0A2U9CJ81_MCL1-01      ------cgacaatgaggaacacactgattggccttgctggatttgctggt
                                    *   **               * ****   * *  *  

A0A2U9BIG9_BCL2L1-      gtggggatgctgacaggagtgctgattgctatgttcatcgctaagaaaca
A0A2U9BY16_BCL2L1-      atgaccctggtgaccggggtcgtggtgggctcactgattgcccagaagcg
A0A2U9BJ09_BCL2-01      gcgagcctcaccatcggagcgtacctcacgcag------aa---------
A0A2U9CJ81_MCL1-01      g------------ttggggcgacactggccctgttgatcag---------
                                       ** *      *                        

A0A2U9BIG9_BCL2L1-      ---gtga
A0A2U9BY16_BCL2L1-      cctgtga
A0A2U9BJ09_BCL2-01      ---gtga
A0A2U9CJ81_MCL1-01      ---gtga
                           ****

© 1998-2022Legal notice