Dataset for CDS BCL-2-like of organism Scophthalmus maximus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2U9BJ09_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL-2 (length=687 residues).
atggcgagcgagtgtaatcgcaatattgtggaaaagtacatctgccataaactctccaagcggggctacgtgtgggggtt
tgatgatgtccgagatgaagatgccgctgataacgggtcgatagttgcccctccaccgactctggtgcgccggtgccatg
gagccagcaccgggcccgacgacgagagccaccccgacctctgtaggcggccgcctcagtccgagccgcgcgccgccgtc
caccgggtcctgcgcgaggcgggcgacgaacttgagagactgtaccagccggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgcagaggcgcttcgccgaggtgatcgacgaactgttccgggacggggtgaactggggccgga
ttatcgcgttcttcgagttcgggggcaccgtgtgcgtggagtgcgccgacaccgaggagatgacatcgcaggtggacaac
atcgcggagtggatgacagagtatttaaatggaccgcttaacagctggattatggacaacgggggatgggacgccttcgt
ggagctgtacgacagacacggggagtccgtcttcagctgctcctggccctccatcaagaccgtcttcggcctggctgcac
tcggggcggcgagcctcaccatcggagcgtacctcacgcagaagtga
>gnl|bcl2dbcds|A0A2U9CJ81_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=873 residues).
atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccggagtcatgggctgcctcattcttcctcaaaa
tggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgccgtgggctccgtgatcgactccc
gcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccaggtctccgcaacgaaggcgtacgcggcc
aagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctccaccccggagtcggacggcga
gcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtggtggaccgactggtg
gagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaacagaagggacgatgtgacgtttgtcgg
cgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctccagcctggtggcgttcggggccgtgg
tgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggagatctccacatacctgctgacg
gaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
aatgaggaacacactgattggccttgctggatttgctggtgttggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=834 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcaggaggattgctgaggcctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=828 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcaggctcctgtggtaa
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=879 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagtgggactctgactttcgctacatccgcttctcctccaagctgcgtaaaaaaatgccagcgctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=903 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagggacacgtgttcatcgctccaaagtgacctccaaccaacaaggcacattccaaagattttcagtt
tgcaaaacagaaggatcctctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=942 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagctgcagcagtgcaaatcgtctgttggggctgcacaaacatgccaacaaattttcagtggatcttg
cagcatcagtgaagcagtgcggcctggaaccccatagcttgcagaaacccttcagcaggtga
>gnl|bcl2dbcds|A0A8D3CTR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=600 residues).
atgtcggacagtaacagagagctggtcgagttcttcatcggctataagctgtcccagaggaactacccgacctctctact
gaggccggaggatgctggtggaaggactgagggagacaaggccaactcagctgccagcaatggcttgttggtcgacggcg
gcaacagggactccgctcatgagtttgaacagctcttcaaccaagcgttcagtgacctctccctgcagctcgacatcacc
cctgacacggcctaccaaagctttaagagtgtgatggacgaggtgttcaaggacggagtcaactggggacgtatagtggg
cctgttcgcttttggcggcgtgctgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgcccgtatcgctgact
ggatgaccatgtacctggatgagcacatcagcccctggatccagagccaaggaggctggggctgctttgcggagattttt
gggcaaggcgccggcgcagaagcaaggagatatcgggagagcgtgaggcgatggctgctagttggagtggggatgctgac
aggagtgctgattgctatgttcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A8D3DY18_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L10 (length=579 residues).
atgtcctgtgggctgtggaaagagaccctggctctggcggaggactacctgtccctctgctgcaagagcccgcggccagc
cccctcgcctcccagcgagtcagccgccgccatgagacgcctggcccgggacatggagaagcagcaccaggctcgcttcc
acgcgctcgcccaggccttcctgcggcagtgcgggccggacccctgcaccagcctcagggcggtgatggaggagctggcg
ggagacggacacttgaactggggcagggtcatctccattttcaccttcgccggggtggtggtcaggcagctgctggagca
ggagggcctgaagccggggctggaccccgggcaggagctggcacaggggcccgggagctgcaggggactggcagagacca
tagccgattacctgggagaggagaagaaggactggctgctggagaacgatggatgggatgggttctgtaagttctcccgc
agtgccagagagatgagccaggactcgtcgatgaagacggctctgtttgctgctgctggcgtggggcttgccggactcac
cttcctgctggtgcgctag
© 1998-2023Legal notice