Dataset for CDS BCL2L1 of organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665VM40_BCL2L1-      atgtctca---aaacagagaactggttgttttctacataaaatataaact
A0A665VSD7_BCL2L1-      atgtcgtacagcaacagagagctggtggagttcttcatacactccaaact
                        *****  *    ******** ***** *  **** **** * *  *****

A0A665VM40_BCL2L1-      ttcccagagaaactatcctctcaaccacatggagttcaatgaatctcttc
A0A665VSD7_BCL2L1-      gcct--------ctggcctcgctgct-----gaggccagagga-------
                          *         **  **** *  *      ***  **  * *       

A0A665VM40_BCL2L1-      acaggactgatggtgggggggcagggttggttgaagaacaaagggtagca
A0A665VSD7_BCL2L1-      -------tgctggtggacagac---------tgaaggagacaagg-----
                               ** ******   * *         ***** * * * **     

A0A665VM40_BCL2L1-      acgcattccaacggaactttt---aatggcacaagttctggaacccggtc
A0A665VSD7_BCL2L1-      -------ccaactcagctgctaggaatggccta-----------cctgtc
                               *****  * **  *   ******  *           ** ***

A0A665VM40_BCL2L1-      agagtccccacaggggcagca---------acacttgg------------
A0A665VSD7_BCL2L1-      at--------cagtgggagcatgctgagttacactaggacccccccaccc
                        *         *** ** ****         ***** **            

A0A665VM40_BCL2L1-      -catca-atgacaagcctggatgcagtgaaggaggccctcctggattctg
A0A665VSD7_BCL2L1-      ccaccatgtgaca----ttgaagctgtaaaggaagctcttagggactcta
                         ** **  *****    * ** ** ** ***** ** **   *** *** 

A0A665VM40_BCL2L1-      ccaacgagtttgaattgcgatactcccgcgccttcagcgacttgcacaac
A0A665VSD7_BCL2L1-      ctgatgagtttgaattcctcttcaggcaagcatttagtgacctttcctca
                        *  * *********** *  * *   *  ** ** ** *** *   *   

A0A665VM40_BCL2L1-      cagctgcatatcacaccggccacagcttacataagctttgaaaacgtgat
A0A665VSD7_BCL2L1-      cagcttgacatcacttctgacacagtctaccagagcttcgagaccgtgat
                        *****  * *****  * * *****  ***   ***** ** * ******

A0A665VM40_BCL2L1-      ggatgaagtgttccgtgacggcgtcaactggggccgcatcatagggcttt
A0A665VSD7_BCL2L1-      ggatgaggtgttcaaggatggcatcaactgggggcggatagtggccctgt
                        ****** ******   ** *** ********** ** **  * *  ** *

A0A665VM40_BCL2L1-      ttgtgtttggtggggcactatgtgtcgagtgcgtggagaaggagatgagt
A0A665VSD7_BCL2L1-      ttgcctttgggggtgaactttgtgtggaatgtgttgagaagaatatgagt
                        ***  ***** ** * *** ***** ** ** ** ****** * ******

A0A665VM40_BCL2L1-      ccactggtggtcaggatcattgaatggatgacagtctacctggacaacaa
A0A665VSD7_BCL2L1-      gagatggttcccagcattgcagagtggatgaccatatacttggatttgca
                            ****   *** **    ** ********  * *** ****     *

A0A665VM40_BCL2L1-      cattcagccctggatccagggtcaaggaggatgggagcattttgctgaac
A0A665VSD7_BCL2L1-      catccgtccatggatcgagacgcaaggaggctgggactgctttgctgaga
                        *** *  ** ****** **   ******** *****    ********  

A0A665VM40_BCL2L1-      tctttgggcacga---tgctgcagcggagagcagaaggtcacaggaaagt
A0A665VSD7_BCL2L1-      tttttgggcagaactccgctgcaacagcgaggaga---tctcaggaggct
                        * ********  *    ****** * * *** ***   ** *****   *

A0A665VM40_BCL2L1-      ttcaccaagtggctgctggcaggaatgaccctgctgactggagttgtggt
A0A665VSD7_BCL2L1-      gcgaggaggtggctgctagttggagtggcgctgctgacaggagtgctgat
                           *  * ********* *  *** ** * ******** *****  ** *

A0A665VM40_BCL2L1-      ggggtcactgatcgccagaaagcgcctgtga
A0A665VSD7_BCL2L1-      gggtgtgctcattgctaagaaaca---gtga
                        ***    ** ** ** *  ** *    ****

© 1998-2020Legal notice