Dataset for CDS BCL2L1 of organism Buteo japonicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0AYR5_BCL2L1-      atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagct
A0A8C0AYR5_BCL2L1-      atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagct
                        **************************************************

A0A8C0AYR5_BCL2L1-      ctcacagaagggatacagctggagtcagctggaggaggaggatgagaaca
A0A8C0AYR5_BCL2L1-      ctcacagaagggatacagctggagtcagctggaggaggaggatgagaaca
                        **************************************************

A0A8C0AYR5_BCL2L1-      ggactgactttgcagcagaggaggccgagatggacggcgtcctcaacggg
A0A8C0AYR5_BCL2L1-      ggactgactttgcagcagaggaggccgagatggacggcgtcctcaacggg
                        **************************************************

A0A8C0AYR5_BCL2L1-      agcccctcctggcacccgcccgccagccacgtagtgaacggagccgccat
A0A8C0AYR5_BCL2L1-      agcccctcctggcacccgcccgccagccacgtagtgaacggagccgccat
                        **************************************************

A0A8C0AYR5_BCL2L1-      gcaccggagcagcctcgaagtccatgaaatcgttcaaacagctgatgtga
A0A8C0AYR5_BCL2L1-      gcaccggagcagcctcgaagtccatgaaatcgttcaaacagctgatgtga
                        **************************************************

A0A8C0AYR5_BCL2L1-      ggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgg
A0A8C0AYR5_BCL2L1-      ggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgg
                        **************************************************

A0A8C0AYR5_BCL2L1-      gctttcagcgacctcacttcccagctccacatcacccctggcacggcgta
A0A8C0AYR5_BCL2L1-      gctttcagcgacctcacttcccagctccacatcacccctggcacggcgta
                        **************************************************

A0A8C0AYR5_BCL2L1-      tcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
A0A8C0AYR5_BCL2L1-      tcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
                        **************************************************

A0A8C0AYR5_BCL2L1-      ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggag
A0A8C0AYR5_BCL2L1-      ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggag
                        **************************************************

A0A8C0AYR5_BCL2L1-      agcgttgacaaggagatgcgggtattggtgggacgcgttgtatcttggat
A0A8C0AYR5_BCL2L1-      agcgttgacaaggagatgcgggtattggtgggacgcgttgtatcttggat
                        **************************************************

A0A8C0AYR5_BCL2L1-      gaccacgtacttgaccgaccacctagatccctggatccaggagaatggcg
A0A8C0AYR5_BCL2L1-      gaccacgtacttgaccgaccacctagatccctggatccaggagaatggcg
                        **************************************************

A0A8C0AYR5_BCL2L1-      gatgg---------------------------------------------
A0A8C0AYR5_BCL2L1-      gatggtccaggccatggcctctgtccccagccctgtcacacacctccctc
                        *****                                             

A0A8C0AYR5_BCL2L1-      -------gagcggtttgtggac----------------ctctacgggaa-
A0A8C0AYR5_BCL2L1-      agagggagag-gggctgtggctgtttgccgtgcagtggctctattgaaat
                               *** **  *****                  *****  * ** 

A0A8C0AYR5_BCL2L1-      -----cga----tgctgctgccgaggtgaggaagggccaggagac-----
A0A8C0AYR5_BCL2L1-      ttgctcggctcttgctgttgct--ggagatgaaggact-ggaggcagccg
                             **     ***** ***   ** ** ***** *  **** *     

A0A8C0AYR5_BCL2L1-      -cttcaacaaatggctcctgaccggggcgacgg------tggcaggagtg
A0A8C0AYR5_BCL2L1-      gcttggacgag-----ccgggccggagtgactgcattcctggcc--aggc
                         ***  ** *      ** * **** * *** *      ****   **  

A0A8C0AYR5_BCL2L1-      cttctgctgggat--ccctgctgagccgcaagtga---------------
A0A8C0AYR5_BCL2L1-      ctcgtgcttggcccgctctcccgaagcccagggaaaggccggagtttcac
                        **  **** **    * ** * **  * ** *  *               

A0A8C0AYR5_BCL2L1-      ---------------------------
A0A8C0AYR5_BCL2L1-      gatccagagtgcctgccttcgccatag
                                                   

© 1998-2022Legal notice