Dataset for CDS BCL2L1 of organism Buteo japonicus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=816 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatggtccag
gccatggcctctgtccccagccctgtcacacacctccctcagagggagaggggctgtggctgtttgccgtgcagtggctc
tattgaaatttgctcggctcttgctgttgctggagatgaaggactggaggcagccggcttggacgagccgggccggagtg
actgcattcctggccaggcctcgtgcttggcccgctctcccgaagcccagggaaaggccggagtttcacgatccagagtg
cctgccttcgccatag
© 1998-2022Legal notice