Dataset for CDS BOK of Organism Gasterosteus aculeatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3PKC3_BOK-01      atggaggtcctgcggcggccgtccgtgatggctgctgaggtcctggatgtgtttgaccga
G3NL58_BOK-01      ------------------------------------------------------------
G3NL58_BOK-02      atggacatgttgcgccgctcgtctgtgttcgcggccgaa---------gtgtttgaccgc
G3NL58_BOK-03      atggacatgttgcgccgctcgtctgtgttcgcggccgaa---------gtgtttgaccgc

G3PKC3_BOK-01      tcgctgacggagaaggagctggtgtcccagtctaaagccctgtgcagggactacatactg
G3NL58_BOK-01      ------------------------------------------------------------
G3NL58_BOK-02      tcgcccaccgacaaggagctggtgtcccaggccaaggcgctgtgccgggactacattcac
G3NL58_BOK-03      tcgcccaccgacaaggagctggtgtcccaggccaaggcgctgtgccgggactacattcac

G3PKC3_BOK-01      tctagactccaccagaatggacagggatggtccaagactgaactccacctctctccctca
G3NL58_BOK-01      ------------------------------------------------------------
G3NL58_BOK-02      tccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggcgcgccgcaccg
G3NL58_BOK-03      tccaggctcaaccgcgccgggatgggctggtcgaagcccgagtccgggcgcgccgcaccg

G3PKC3_BOK-01      agtgcagcgctcgccgaggtgtctttggtgctcctctgccttggcgacgagctggagtcc
G3NL58_BOK-01      ----------------atgtct--------------tggccaggtgatgagttggagtac
G3NL58_BOK-02      ggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtac
G3NL58_BOK-03      ggcggcgggctgggagacgtctcctcggccctgctgtggctgggtgatgagttggagtac
                                   * ** *              ** *  ** ** *** ****** *

G3PKC3_BOK-01      atacggcccagtttgtacaggaacgtggcgcggcagctcaacatctctgttgccatggag
G3NL58_BOK-01      cttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggag
G3NL58_BOK-02      cttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggag
G3NL58_BOK-03      cttcgacccaacgtgtaccgcaacgttgcgcggcagctaaacatcacggtggcgtcggag
                    * ** ****   ***** * ***** *********** ****** * ** **   ****

G3PKC3_BOK-01      aacatggtttcagatgccttcatcggcgtggcaacggagatcttctcaacagggatcaca
G3NL58_BOK-01      agcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgaca
G3NL58_BOK-02      agcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgaca
G3NL58_BOK-03      agcattgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgaca
                   * *** ** ** ********* * *  *****  * ** ** ***** *****  * ***

G3PKC3_BOK-01      tggggaaaggtggtgtccatgtatgcagtagccggagccctggcggtggactgtgtccgt
G3NL58_BOK-01      tgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggactgcgttcgc
G3NL58_BOK-02      tgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggactgcgttcgc
G3NL58_BOK-03      tgggggaaggtggtgtctctgtacgccgtggcgggagccctggctgtggactgcgttcgc
                   ***** ***********  **** ** ** ** *********** ******** ** ** 

G3PKC3_BOK-01      cagggccacccagccaccgttcacatcttggtggccagtctgggacagtttgtccgcaag
G3NL58_BOK-01      cacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaag
G3NL58_BOK-02      cacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaag
G3NL58_BOK-03      cacggccacccagctattgtccataccattgtcgactgcatgggggagtttgtccgcaag
                   ** *********** *  ** ** * * * ** * * *  ****  **************

G3PKC3_BOK-01      tttctggtcccctggctgaagagacggggaggatgggcggagatgtgtaaatgtgtgttg
G3NL58_BOK-01      agcctgaccacctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtg
G3NL58_BOK-02      agcctgaccacctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtg
G3NL58_BOK-03      agcctgaccacctggctgaaaaggagagggggctgggtggatgttacgaaatgcgtggtg
                      ***  * ********** **  * ** ** **** ***  *    ***** *** **

G3PKC3_BOK-01      aagaaggatcttcccccggagcaccactggctgtcgtctgcaatggattccctgaaatac
G3NL58_BOK-01      aacacagaccccagcttccgctctcactggctggtgtcggccgtctgtgccttcggacac
G3NL58_BOK-02      aacacagaccccagcttccgctctcactggctggtgtcggccgtctgtgccttcggacac
G3NL58_BOK-03      aacacagaccccagcttccgctctcactggctggtgtcggccgtctgtgccttcggacac
                   ** *  ** *    *         *********  *** **  *   * ** *   * **

G3PKC3_BOK-01      ttcct------caccgcgctgtacgtctgcgtcatgaaggagccgtga
G3NL58_BOK-01      tatctgaaggccactgtgttgtacctcctc------agagacacgtga
G3NL58_BOK-02      tatctgaaggccactgtgttgtacctcctc------agagacacgtga
G3NL58_BOK-03      tatctgaaggccactgtgttgtacctcctc------agagacacgtga
                   *  **      *** * * ***** **  *      *  **  *****

© 1998-2023Legal notice