Dataset for CDS Unclassified of organism Mus musculus

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|G3XA70_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Mus musculus (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3XA70_uncBCL2L2-02 Putative BCL2-like 2 gene OS=[Eukaryota] Mus musculus (length=240 residues).
atggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtctggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3XA70_uncBCL2L2-03 Putative BCL2-like 2 gene OS=[Eukaryota] Mus musculus (length=537 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggtaagaagttctcaattgctgctctccgcatccctctacaaagttggt
cttcatgggaaaatagggcctctgatgggaggctggggttgtgctgggaagggctga
>gnl|bcl2dbcds|G3XA70_uncBCL2L2-04 Putative BCL2-like 2 gene OS=[Eukaryota] Mus musculus (length=351 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcct
© 1998-2023Legal notice