Dataset for CDS Unclassified of organism Anolis carolinensis

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A803STF8_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Anolis carolinensis (length=480 residues).
atggattggacccaccctgacagattaccagaaattgaaaaacaaacgttcaggattattcaatcttacctgaatttggc
agctggaaaagcccccaaaacatcattagatactgagatatgtatctctttacaaaaaatgaatgagttggatgccagga
tctttcctataatatcacctctgcaattggacactcccacacagagctgtgaaatccttcaacatgtgatgcagcaaaca
ttttccgatggcaagattaactggggcagaattttttctataatattatttggatgcattttagtcagaaaaatgcccta
cacagaagttcatgtcgataatgtagctgaatgcatcgcagcattcttgctagatcatgaatctaaatggctttgccgtc
atggaggcttggtaaaatcttatttctcattttttctaggaacatggggtgaaatacatgaatgctctaatggatggtaa
>gnl|bcl2dbcds|A0A803TIE0_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Anolis carolinensis (length=459 residues).
ctaaacacaatcacgtgtggctatttctcatatttacagagagatgttctgtggggcatacaattacctcgagtttttga
agttgatagattggtagtctttggagtgggcatgttggtctccttatctggaaatagctgtgaaatccttcaacatgtga
tgcagcaaacattttccgatggcaagattaactggggcagaattttttctataatattatttggatgcattttagtcaga
aaaatgccctacacagaagttcatgtcgataatgtagctgaatgcatcggttgttgtatgtcttttgggctgaatggcca
tgttccaaaagtattctctcctaataataataataataataataataataataataataatactttatttataccccgcc
accatctccccaatggggacatctatggcaggcatcctcagaggttaaattatatataa
>gnl|bcl2dbcds|A0A803TYD1_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Anolis carolinensis (length=513 residues).
atgacgaagtgcttgttctgtggaaaacagacaatcatttcagaaaagacacacacacactggaaattgaaaaacaaacc
gttcaggattattcaatcttacctgaatttggcagctggaaaagcccccaaaacatcattagatactgagatatgtatct
ctttacaaaaaatgaatgagttggatgccaggatctttcctataatatcacctctgcaattggacactcccacacagagc
tgtgaaatccttcaacatgtgatgcagcaaacattttccgatggcaagattaactggggcagaattttttctataatatt
atttggatgcattttagtcagaaaaatgccctacacagaagttcatgtcgataatgtagctgaatgcatcgcagcattct
tgctagatcatgaatctaaatggctttgccgtcatggaggcttggtaaaatcttatttctcattttttctaggaacatgg
ggtgaaatacatgaatgctctaatggatggtaa
© 1998-2022Legal notice