Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
                                                                          

G3V977_BCL2A1-01        ----------------------------atga-----cagactgtgagtt
Q925A9_BCL2A1-01        ----------------------------atga-----cagactgtgagtt
Q7TS62_BCL2L1-01        ----------------------------atgt-----ct------cagag
Q7TS62_BCL2L1-02        ----------------------------atgt-----ct------cagag
Q7TS62_BCL2L1-03        ----------------------------atgt-----ct------cagag
A0A8I5Y8B7_MCL1-01      ----------------------------aagt-----ttggcctgcggag
A0A8I5ZM43_MCL1-01      ----------------------------atgt-----ttggcctgtggag
O88996_BCL2L2-01        ----------------------------atggcgaccccagcctcaaccc
Q7TS60_BCL2L2-01        gtcatccttgcccctttcagccgcccggatggcgaccccagcctcaaccc
Q7TSN8_BCL2-01          ----------------------------atggcg---caagccgggagaa
A0A8I6AJ02_BCL2-01      ----------------------------atggcg---caagccgggagaa
P49950_BCL2-01          ----------------------------atggcg---caagccgggagaa
                                                    * *                   

G3V977_BCL2A1-01        ca----tgtatatccactccctggctgagaactatcttcagtatgtcctg
Q925A9_BCL2A1-01        ca----tgtatatccactccctggctgagaactatcttcagtatgtcctg
Q7TS62_BCL2L1-01        ca----------accgggagctggtggttgactttctctcctacaagctc
Q7TS62_BCL2L1-02        ca----------accgggagctggtggttgactttctctcctacaagctc
Q7TS62_BCL2L1-03        ca----------accgggagctggtggttgactttctctcctacaagctc
A0A8I5Y8B7_MCL1-01      aa----------acggggtaatgggcttgaacctgtactgctataatctt
A0A8I5ZM43_MCL1-01      aa----------acactgtaatccccttgaacctgaactg-tacagccag
O88996_BCL2L2-01        ca------gacacacgggctctagtggctgactttgtaggctataagctg
Q7TS60_BCL2L2-01        ca------gacacacgggctctagtggctgactttgtaggctataagctg
Q7TSN8_BCL2-01          cagggtatgataaccgggagatcgtgatgaagtacatacattataagctg
A0A8I6AJ02_BCL2-01      cagggtatgataaccgggagatcgtgatgaagtacatccattataagctg
P49950_BCL2-01          cagggtatgataaccgggagatcgtgatgaagtacatccattataagctg
                         *                   *        *          **    *  

G3V977_BCL2A1-01        caggtacctgcctttgaatcggctc-------------caagcaaaacgt
Q925A9_BCL2A1-01        caggtacctgcctttgaatcggctc-------------caagcaaaacgt
Q7TS62_BCL2L1-01        tcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaacag
Q7TS62_BCL2L1-02        tcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaacag
Q7TS62_BCL2L1-03        tcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaacag
A0A8I5Y8B7_MCL1-01      gc--------------gcta----------cttgctacttgtgggagcag
A0A8I5ZM43_MCL1-01      tc--------------gctggagatcatctcctgctgcctgcgggagcag
O88996_BCL2L2-01        aggcagaagggttatgtctgtggag-------------ctgg--------
Q7TS60_BCL2L2-01        aggcagaagggttatgtctgtggag-------------ctgg--------
Q7TSN8_BCL2-01          tcacagaggggctacgagtgggatg-------------ctggagatgcgg
A0A8I6AJ02_BCL2-01      tcacagaggggctacgagtgggata-------------ctggagatgaag
P49950_BCL2-01          tcacagaggggctacgagtgggata-------------ctggagatgaag
                                          *                               

G3V977_BCL2A1-01        ccagagtgctacagagagttgct---------------------------
Q925A9_BCL2A1-01        ccagagtgctacagagagttgct---------------------------
Q7TS62_BCL2L1-01        gactgaagccccagaagaaactgaaccagaaagggagacccccagtgcca
Q7TS62_BCL2L1-02        gactgaagccccagaagaaactgaaccagaaagggagacccccagtgcca
Q7TS62_BCL2L1-03        gactgaagccccagaagaaactgaaccagaaagggagacccccagtgcca
A0A8I5Y8B7_MCL1-01      gcgaccggctcc--aaggacgctaa-------------------------
A0A8I5ZM43_MCL1-01      a-gacaggctcc--aaggacctgaa-------------------------
O88996_BCL2L2-01        ---------ccctggggaaggc-----------------------cc---
Q7TS60_BCL2L2-01        ---------ccctggggaaggc-----------------------cc---
Q7TSN8_BCL2-01          acgcggcgcccctgggggctgc-----------------------cccca
A0A8I6AJ02_BCL2-01      actccgcgcccctgagggctgc-----------------------cccca
P49950_BCL2-01          actccgcgcccctgagggctgc-----------------------cccca
                                   *                                      

G3V977_BCL2A1-01        -----------------------------------------ttctctgta
Q925A9_BCL2A1-01        -----------------------------------------ttctctgta
Q7TS62_BCL2L1-01        tcaatggcaacccatcctggcacctggcggatagc------cccgcggtg
Q7TS62_BCL2L1-02        tcaatggcaacccatcctggcacctggcggatagc------cccgcggtg
Q7TS62_BCL2L1-03        tcaatggcaacccatcctggcacctggcggatagc------cccgcggtg
A0A8I5Y8B7_MCL1-01      -------------------gcctcttggcgaggtc------ccc-tgggg
A0A8I5ZM43_MCL1-01      -------------------gcctctgggagaggac------cccgcgggg
O88996_BCL2L2-01        -----------------------------agcagccga---cccgc--tg
Q7TS60_BCL2L2-01        -----------------------------agcagccga---cccgc--tg
Q7TSN8_BCL2-01          cccctggcatcttctccttccagcctgagagcaacccaatgcccgctgtg
A0A8I6AJ02_BCL2-01      cccctggcatcttctccttccagcctgagagcaaccggacgcccgctgtg
P49950_BCL2-01          cccctggcatcttctccttccagcctgagagcaaccgaacgcccgctgtg
                                                                   *      

G3V977_BCL2A1-01        caaaaggaagttg-------------------------------------
Q925A9_BCL2A1-01        caaaaggaagttg-------------------------------------
Q7TS62_BCL2L1-01        aatggagccactg---------------------gccacagcagcagttt
Q7TS62_BCL2L1-02        aatggagccactg---------------------gccacagcagcagttt
Q7TS62_BCL2L1-03        aatggagccactg---------------------gccacagcagcagttt
A0A8I5Y8B7_MCL1-01      c---gggccagag---------------------ggcgctggagaccctg
A0A8I5ZM43_MCL1-01      c---gggctggag---------------------ggcactggagaccctg
O88996_BCL2L2-01        caccaagccatg--------------------------------------
Q7TS60_BCL2L2-01        caccaagccatg--------------------------------------
Q7TSN8_BCL2-01          caccgggacatggctgccaggacgtctcctctcaggcccctcgttgccac
A0A8I6AJ02_BCL2-01      caccgagacacggctgccaggacgtcgcctctacggccccttgtcgccac
P49950_BCL2-01          caccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaa
                              *                                           

G3V977_BCL2A1-01        ------------------------------------------------aa
Q925A9_BCL2A1-01        ------------------------------------------------aa
Q7TS62_BCL2L1-01        ggatgcgcgggaggtaatccccatggcagcagtga---agcaagcgctga
Q7TS62_BCL2L1-02        ggatgcgcgggaggtaatccccatggcagcagtga---agcaagcgctga
Q7TS62_BCL2L1-03        ggatgcgcgggaggtaatccccatggcagcagtga---agcaagcgctga
A0A8I5Y8B7_MCL1-01      gggcgcttgagcgatcaggtgcagcccaaccatga---------------
A0A8I5ZM43_MCL1-01      cagcgcatgggcaacagcacccagctcaaccagga---------------
O88996_BCL2L2-01        ---cgggc------------------------------------------
Q7TS60_BCL2L2-01        ---cgggc------------------------------------------
Q7TSN8_BCL2-01          cgctgggcctgcgctcagccctgtgccacctgtggtccatctgaccctcc
A0A8I6AJ02_BCL2-01      cgctgggcctgcgctcagccctgtgccacctgtggtccacctgaccctcc
P49950_BCL2-01          cgctgggcctgcgctcagccctgtgccacctgtggtccacctgaccctcc
                                                                          

G3V977_BCL2A1-01        aagaatctgaagccatacttggatgactttcacgtgga------------
Q925A9_BCL2A1-01        aagaatctgaagccatacttggatgactttcacgtgga------------
Q7TS62_BCL2L1-01        gagaggctggcgatgagtttgaactgcggtaccggagagcattcagtgat
Q7TS62_BCL2L1-02        gagaggctggcgatgagtttgaactgcggtaccggagagcattcagtgat
Q7TS62_BCL2L1-03        gagaggctggcgatgagtttgaactgcggtaccggagagcattcagtgat
A0A8I5Y8B7_MCL1-01      ---------------------gactgccttccagggcgtgcttcagaaac
A0A8I5ZM43_MCL1-01      ---------------------gacagccttccagggcatgcttctgaaac
O88996_BCL2L2-01        ----agctggagacgagtttgagacccgcttccggcgcaccttctctgac
Q7TS60_BCL2L2-01        ----agctggagacgagtttgagacccgcttccggcgcaccttctctgac
Q7TSN8_BCL2-01          gccgggctggggatgacttctctcgtcgctaccgtcgtgacttcgcagag
A0A8I6AJ02_BCL2-01      gccgggctggggatgacttctctcgtcgctaccgtcgcgactttgcagag
P49950_BCL2-01          gccgggctggggatgacttctctcgtcgctaccgtcgcgactttgcagag
                                                  *  *   *                

G3V977_BCL2A1-01        --------------------atccatagatactgccagaataatattc-a
Q925A9_BCL2A1-01        --------------------atccatagatactgccagaataatattc-a
Q7TS62_BCL2L1-01        ctaacatcccagcttcatataaccccagggacagcatatcagagcttt-g
Q7TS62_BCL2L1-02        ctaacatcccagcttcatataaccccagggacagcatatcagagcttt-g
Q7TS62_BCL2L1-03        ctaacatcccagcttcatataaccccagggacagcatatcagagcttt-g
A0A8I5Y8B7_MCL1-01      tggacat------------taaaaacgaagaca--atttcagtggttt--
A0A8I5ZM43_MCL1-01      tggacat------------taaacacgaagaca--atgttaaatcttttt
O88996_BCL2L2-01        ctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttc-a
Q7TS60_BCL2L2-01        ctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttc-a
Q7TSN8_BCL2-01          atgtccagtcagctgcacctgacgcccttcaccgcgaggggacgcttt-g
A0A8I6AJ02_BCL2-01      atgtccagtcagctgcacctgacgcccttcaccgcgaggggacgcttt-g
P49950_BCL2-01          atgtccagtcagctgcacctgacgcccttcaccgcgaggggacgcttt-g
                                                       *             **   

G3V977_BCL2A1-01        accaagtgatggaaaaagaatttgaagatggcatcattaactggggaagg
Q925A9_BCL2A1-01        accaagtgatggaaaaagaatttgaagatggcatcattaactggggaagg
Q7TS62_BCL2L1-01        aacaggtagtgaatgaactctttcgggatggggt---aaactggggtcgc
Q7TS62_BCL2L1-02        aacaggtagtgaatgaactctttcgggatggggt---aaactggggtcgc
Q7TS62_BCL2L1-03        aacaggtagtgaatgaactctttcgggatggggt---aaactggggtcgc
A0A8I5Y8B7_MCL1-01      -------------ccatgttttcaaagatggattaacaaactggggcagg
A0A8I5ZM43_MCL1-01      ctcgagtgatgactcatgttttcaaagatggcgtaacaaactggggcagg
O88996_BCL2L2-01        cccaggtttccgacgaacttttccaagggggccc---caactggggccgt
Q7TS60_BCL2L2-01        cccaggtttccgacgaacttttccaagggggccc---caactggggccgt
Q7TSN8_BCL2-01          ccacggtggtggaggaactcttcagggatggggt---gaactgggggagg
A0A8I6AJ02_BCL2-01      ccacggtggtggaggaactcttcagggatggggt---gaactgggggagg
P49950_BCL2-01          ccacggtggtggaggaactcttcagggatggggt---gaactgggggagg
                                       *    **    *  **       ********  * 

G3V977_BCL2A1-01        attgtgactatatt-------tgcctt--tgggggtgttct--cctgaaa
Q925A9_BCL2A1-01        attgtgactatatt-------tgcctt--tgggggtgttct--cctgaaa
Q7TS62_BCL2L1-01        attgtggccttcttct-------cctt--tggcggggcactgtgcgtgga
Q7TS62_BCL2L1-02        attgtggccttcttct-------cctt--tggcggggcactgtgcgtgga
Q7TS62_BCL2L1-03        attgtggccttcttct-------cctt--tggcggggcactgtgcgtgga
A0A8I5Y8B7_MCL1-01      ----------atttcttttggtgcctttgtggccaaacact-----taaa
A0A8I5ZM43_MCL1-01      attgtgactcatttcttttggtgcctttgtggccaaacact-----taaa
O88996_BCL2L2-01        cttgtggcattctt-------tgtctt--tggggctgccctgtgtgctga
Q7TS60_BCL2L2-01        cttgtggcattctt-------tgtctt--tggggctgccctgtgtgctga
Q7TSN8_BCL2-01          attgtggccttctt-------tgagtt--cggtggggtcatgtgtgtgga
A0A8I6AJ02_BCL2-01      attgtggccttctt-------tgagtt--cggtggggtcatgtgtgtgga
P49950_BCL2-01          attgtggccttctt-------tgagtt--cggtggggtcatgtgtgtggg
                                    **           **   **        *         

G3V977_BCL2A1-01        aagcttccacaagagcagattgccctggatgtggatacttacaa------
Q925A9_BCL2A1-01        aagcttccacaagagcagattggcctggatgtggatacttacaa------
Q7TS62_BCL2L1-01        aagcgtagacaagg------------agatgcaggtattggtga------
Q7TS62_BCL2L1-02        aagcgtagacaagg------------agatgcaggtattggtga------
Q7TS62_BCL2L1-03        aagcgtagacaagg------------agatgcaggtattggtga------
A0A8I5Y8B7_MCL1-01      gagcctaaaccaag------------a---------------aa------
A0A8I5ZM43_MCL1-01      gagctgaaaccaag------------a---------------aa------
O88996_BCL2L2-01        gagtgtcaacaaag------------aaatggagccattggtgggacaag
Q7TS60_BCL2L2-01        gagtgtcaacaaag------------aaatggagccattggtgggacaag
Q7TSN8_BCL2-01          gagcgtcaacaggg------------agatgtcacccctggtgg------
A0A8I6AJ02_BCL2-01      gagcgtcaacaggg------------agatgtcacccctggtgg------
P49950_BCL2-01          gagcgtcaacaggg------------agatgtcacccctggtgg------
                         **     **                                        

G3V977_BCL2A1-01        -gcaagtttccagttttg-tggcggaattcataatga-ataacacaggag
Q925A9_BCL2A1-01        -gcaagtttccagttttg-tggcggaattcataatga-ataacacaggag
Q7TS62_BCL2L1-01        -gtcggattgcaagttggatggccacctacctgaatg-accacctagagc
Q7TS62_BCL2L1-02        -gtcggattgcaagttggatggccacctacctgaatg-accacctagagc
Q7TS62_BCL2L1-03        -gtcggattgcaagttggatggccacctacctgaatg-accacctagagc
A0A8I5Y8B7_MCL1-01      -gctgcatcgaacctt-----------tagcagaaagtatcacagag---
A0A8I5ZM43_MCL1-01      -gctgcatc-cacctt-----------tagcagaaagtatcacaaaagtt
O88996_BCL2L2-01        tgcaggat-------tggatggtgacctacctggaga-cacgcttggctg
Q7TS60_BCL2L2-01        tgcaggat-------tggatggtgacctacctggaga-cacgcttggctg
Q7TSN8_BCL2-01          -acaacatcgccctgtggatgactgagtacctgaacc-ggcatctgcaca
A0A8I6AJ02_BCL2-01      -acaacatcgctctgtggatgactgagtacctgaacc-ggcatctgcaca
P49950_BCL2-01          -acaacatcgctctgtggatgactgagtacctgaacc-ggcatctgcaca
                               *       *           *                      

G3V977_BCL2A1-01        aatggatacagcagaatggaggctgg------------------------
Q925A9_BCL2A1-01        aatggatacagcagaatggaggctgg------------------------
Q7TS62_BCL2L1-01        cttggatccaggagaacggcggctgg------------------------
Q7TS62_BCL2L1-02        cttggatccaggagaacggcggctgggtaagaaccacgccccttgtgtgt
Q7TS62_BCL2L1-03        cttggatccaggagaacggcggctgggtaagaaccacgccccttgtgtgt
A0A8I5Y8B7_MCL1-01      ---g----------------------------------------------
A0A8I5ZM43_MCL1-01      cttg----------------------------------------------
O88996_BCL2L2-01        actggatccacagcagtgggggctgg------------------------
Q7TS60_BCL2L2-01        actggatccacagcagtgggggctgg------------------------
Q7TSN8_BCL2-01          cctggatccaggataacggaggctgg------------------------
A0A8I6AJ02_BCL2-01      cctggatccaggataacggaggctgg------------------------
P49950_BCL2-01          cctggatccaggataacggaggctgg------------------------
                           *                                              

G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
Q7TS62_BCL2L1-01        --gacacttttgtggatctctacgggaacaatgc--agcagcc-------
Q7TS62_BCL2L1-02        ccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttg
Q7TS62_BCL2L1-03        ccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttg
A0A8I5Y8B7_MCL1-01      ----ttcttgtaag------------gaagaagcataactggctt-----
A0A8I5ZM43_MCL1-01      ----ttcttgtaag------------gacgaagcttaactggctt-----
O88996_BCL2L2-01        --gcggagttcacagctctatacggggacggggccctggag---------
Q7TS60_BCL2L2-01        --gcggagttcacagctctatacggggacggggccctggag---------
Q7TSN8_BCL2-01          --gatgcctttgtggaactatatggccccag-------------------
A0A8I6AJ02_BCL2-01      --g-----------------------------------------------
P49950_BCL2-01          --gatgcctttgtggaactatatggccccag-------------------
                                                                          

G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------gagagccggaaaggccaggag---------
Q7TS62_BCL2L1-02        gtctcctggcatggttgttgaagatatcgattattcaggagacattcctg
Q7TS62_BCL2L1-03        gtctcctggcatggttgttgaagatatcgattattcaggagacattcctg
A0A8I5Y8B7_MCL1-01      --------------------gtgaaacaaagaggctgggatgggtttgtg
A0A8I5ZM43_MCL1-01      --------------------gtgaaacaaagaggatgggatgggtttgtg
O88996_BCL2L2-01        --------------------gaggcacggcgtctgcgggaggggaactgg
Q7TS60_BCL2L2-01        --------------------gaggcacggcgtctgcgggaggggaactgg
Q7TSN8_BCL2-01          ----------------------catgcgacctctgtttgatttctcctgg
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          ----------------------catgcgacctctgtttgatttctcctgg
                                                                          

G3V977_BCL2A1-01        --------------------------------------gaagatggcttc
Q925A9_BCL2A1-01        --------------------------------------gaagatggcttc
Q7TS62_BCL2L1-01        ----cgtttcaaccgctg-----------------------------gtt
Q7TS62_BCL2L1-02        gcttcactttaataccaggggttaactttgggaatattgatgaccctgtt
Q7TS62_BCL2L1-03        gcttcactttaataccaggggttaactttgggaatattgatgaccctgtt
A0A8I5Y8B7_MCL1-01      gagttcttccacttacaggaccta--------------gaaggcagcatc
A0A8I5ZM43_MCL1-01      gagttcttccacttacaggaccta--------------gaaggcagcatc
O88996_BCL2L2-01        gcatcagt------------------------------gaggacagtgct
Q7TS60_BCL2L2-01        gcatcagt------------------------------gaggacagtgct
Q7TSN8_BCL2-01          ctgtctct------------------------------gaagaccctgct
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          ctgtctct------------------------------gaagacgctgct
                                                                          

G3V977_BCL2A1-01        acaaagaagtttgaaccta--aatctggctggct----------------
Q925A9_BCL2A1-01        acaaagaagtttgaaccta--aatctggctggct----------------
Q7TS62_BCL2L1-01        cctgacgggcatg--------actgtggctg-----gtg-----------
Q7TS62_BCL2L1-02        tttaaggaacctgtatttttcattctggctacccttgtggccccgcagtt
Q7TS62_BCL2L1-03        tttaaggaacctgtatttttcattctggctacccttgtggccccgcagtt
A0A8I5Y8B7_MCL1-01      ----agaaatgtg--------ctgctggctt---ttgtg-----------
A0A8I5ZM43_MCL1-01      ----agaaatgtg--------ttgctggctt---ttgtg-----------
O88996_BCL2L2-01        gacgggggctgtg--------gcactgggggccctggta-----------
Q7TS60_BCL2L2-01        gacgggggctgtg--------gcactgggggccctggta-----------
Q7TSN8_BCL2-01          cagcctggccctg--------g---tcggggcctgcatc-----------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          cagcctggccctg--------g---tgggggcctgcatc-----------
                                                                          

G3V977_BCL2A1-01        ----gacttttctgcagatgacagggaa---gatctgggaaatgctcttt
Q925A9_BCL2A1-01        ----gacttttctgcagatgacagggaa---gatctgggaaatgctcttt
Q7TS62_BCL2L1-01        ---tagttctgctgggctcactcttcagtcggaagtga------------
Q7TS62_BCL2L1-02        tcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtgttta
Q7TS62_BCL2L1-03        tcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtgttta
A0A8I5Y8B7_MCL1-01      ----ggtgttgct------------------ggagtaggggctggtctgg
A0A8I5ZM43_MCL1-01      ----ggtgttgct------------------ggagtaggggctggtctgg
O88996_BCL2L2-01        -------------------------------actgtaggggccttttttg
Q7TS60_BCL2L2-01        -------------------------------actgtaggggccttttttg
Q7TSN8_BCL2-01          -------------------------------actctgggtgcatacctgg
A0A8I6AJ02_BCL2-01      -----------------------------------taggtgcatgtctgg
P49950_BCL2-01          -------------------------------actctgggtgcatacctgg
                                                                          

G3V977_BCL2A1-01        ctcctcaagcaacactactga
Q925A9_BCL2A1-01        ctcctcaagcaacactactga
Q7TS62_BCL2L1-01        ---------------------
Q7TS62_BCL2L1-02        cttggcttaaaa----cctag
Q7TS62_BCL2L1-03        cttggcttaaaa----cctag
A0A8I5Y8B7_MCL1-01      catatctaataa----ggtag
A0A8I5ZM43_MCL1-01      catatctaataa----ggtag
O88996_BCL2L2-01        ctagc------a----agtga
Q7TS60_BCL2L2-01        ctagc------a----agtga
Q7TSN8_BCL2-01          gccac------a----agtga
A0A8I6AJ02_BCL2-01      t---t------g----aatga
P49950_BCL2-01          gccac------a----agtga
                                             

© 1998-2023Legal notice