Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct
P49950_BCL2-01         --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ----------------------------atg-------------------
Q9Z1P3_MCL1-01         ----------------------------atgtttggccttcggagaaacg
O88996_BCL2L2-01       ----------------------------atg-------------------
Q7TS60_BCL2L2-01       gtcatccttgcccctttcagccgcccggatg-------------------
P49950_BCL2-01         ----------------------------atg-------------------
Q7TSN8_BCL2-01         ----------------------------atg-------------------
G3V977_BCL2A1-01       ----------------------------atg-------------------
Q925A9_BCL2A1-01       ----------------------------atg-------------------
P53563_BCL2L1-01       ----------------------------atg-------------------
P53563_BCL2L1-02       ----------------------------atg-------------------
P53563_BCL2L1-03       ----------------------------atg-------------------
                                                   ***                   

Q99M66_BCL2L10-01      -ggtgacccgct--------------------------------------
Q9Z1P3_MCL1-01         cggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggc
O88996_BCL2L2-01       ------------------------------------------gcgacccc
Q7TS60_BCL2L2-01       ------------------------------------------gcgacccc
P49950_BCL2-01         ------------------------------------------gcg---ca
Q7TSN8_BCL2-01         ------------------------------------------gcg---ca
G3V977_BCL2A1-01       ------------------------------------------ac------
Q925A9_BCL2A1-01       ------------------------------------------ac------
P53563_BCL2L1-01       ------------------------------------------tct-----
P53563_BCL2L1-02       ------------------------------------------tct-----
P53563_BCL2L1-03       ------------------------------------------tct-----
                                                                         

Q99M66_BCL2L10-01      ------------gcaggatcgcactagacggctgctgactgacta-----
Q9Z1P3_MCL1-01         ggcggctctccggccgggacgcgcctggcggccgagga--ggccaaggcg
O88996_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactt-----
Q7TS60_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactt-----
P49950_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagta-----
Q7TSN8_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagta-----
G3V977_BCL2A1-01       ---------------------agactgtgagttcatg-------------
Q925A9_BCL2A1-01       ---------------------agactgtgagttcatg-------------
P53563_BCL2L1-01       ----------------cagagcaaccgggagctggtggttgactt-----
P53563_BCL2L1-02       ----------------cagagcaaccgggagctggtggttgactt-----
P53563_BCL2L1-03       ----------------cagagcaaccgggagctggtggttgactt-----
                                                 *         *             

Q99M66_BCL2L10-01      --------------------------catattgttctgcgcac-------
Q9Z1P3_MCL1-01         cggcgcgaggggggaggggaggccgctctgctgcccggcgcgcgggtggt
O88996_BCL2L2-01       -------------------tgtaggctataagctgaggcagaagggttat
Q7TS60_BCL2L2-01       -------------------tgtaggctataagctgaggcagaagggttat
P49950_BCL2-01         -------------------catccattataagctgtcacagaggggctac
Q7TSN8_BCL2-01         -------------------catacattataagctgtcacagaggggctac
G3V977_BCL2A1-01       --------------------------tatatccactccctg---------
Q925A9_BCL2A1-01       --------------------------tatatccactccctg---------
P53563_BCL2L1-01       -------------------tctctcctacaagctctcccagaaaggatac
P53563_BCL2L1-02       -------------------tctctcctacaagctctcccagaaaggatac
P53563_BCL2L1-03       -------------------tctctcctacaagctctcccagaaaggatac
                                                             *           

Q99M66_BCL2L10-01      ------------------gggcgccgaacacccctgagccactgccc---
Q9Z1P3_MCL1-01         cgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcgg
O88996_BCL2L2-01       gtctg-------------tggagctgg-----------------ccctgg
Q7TS60_BCL2L2-01       gtctg-------------tggagctgg-----------------ccctgg
P49950_BCL2-01         gagtg-------------ggatactggagatgaagactccgcgcccctga
Q7TSN8_BCL2-01         gagtg-------------ggatgctggagatgcggacgcggcgcccctgg
G3V977_BCL2A1-01       -gctgagaactatcttcagtatgtc-------------ctgcag------
Q925A9_BCL2A1-01       -gctgagaactatcttcagtatgtc-------------ctgcag------
P53563_BCL2L1-01       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
P53563_BCL2L1-02       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
P53563_BCL2L1-03       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
                                                                         

Q99M66_BCL2L10-01      -------acgtctgttga--------ggcggccttgctgcgctctgtgac
Q9Z1P3_MCL1-01         cagagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgag
O88996_BCL2L2-01       ggaa-----------------------------------ggccc------
Q7TS60_BCL2L2-01       ggaa-----------------------------------ggccc------
P49950_BCL2-01         gggc-----------------------------------tgcccccaccc
Q7TSN8_BCL2-01         gggc-----------------------------------tgcccccaccc
G3V977_BCL2A1-01       --------gtacc--------------------------tgcctttga--
Q925A9_BCL2A1-01       --------gtacc--------------------------tgcctttga--
P53563_BCL2L1-01       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
P53563_BCL2L1-02       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
P53563_BCL2L1-03       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
                                                               **        

Q99M66_BCL2L10-01      tag----------------------tcagatcc----aacaggagc----
Q9Z1P3_MCL1-01         gagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgg-
O88996_BCL2L2-01       -------------------------------------------agcagcc
Q7TS60_BCL2L2-01       -------------------------------------------agcagcc
P49950_BCL2-01         ctg-----------------gcatcttctccttccagcctgagagcaacc
Q7TSN8_BCL2-01         ctg-----------------gcatcttctccttccagcctgagagcaacc
G3V977_BCL2A1-01       ------------------------atc--ggctccaagcaaaacgt----
Q925A9_BCL2A1-01       ------------------------atc--ggctccaagcaaaacgt----
P53563_BCL2L1-01       gca-----------------acccatcctggcacctggcggatagc----
P53563_BCL2L1-02       gca-----------------acccatcctggcacctggcggatagc----
P53563_BCL2L1-03       gca-----------------acccatcctggcacctggcggatagc----
                                                                   *     

Q99M66_BCL2L10-01      --------------accaggatcttttcaac-------------tccttc
Q9Z1P3_MCL1-01         -----acggctgtgagccggaggtgctcagcaaacgcccggcggtgctgc
O88996_BCL2L2-01       ga---cccgc--tgcaccaagccatg------------------------
Q7TS60_BCL2L2-01       ga---cccgc--tgcaccaagccatg------------------------
P49950_BCL2-01         gaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacgg
Q7TSN8_BCL2-01         caatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcagg
G3V977_BCL2A1-01       -----ccagag------------------------------------tgc
Q925A9_BCL2A1-01       -----ccagag------------------------------------tgc
P53563_BCL2L1-01       -----cccgcggtgaatggagccact---------------------ggc
P53563_BCL2L1-02       -----cccgcggtgaatggagccact---------------------ggc
P53563_BCL2L1-03       -----cccgcggtgaatggagccact---------------------ggc
                                                                         

Q99M66_BCL2L10-01      cgcgact----------accagggcaaccg-----cctggagctggtgac
Q9Z1P3_MCL1-01         ccctactggagcgcgtgagcgaggcggctaagagctccggagctgacggc
O88996_BCL2L2-01       -----------------cgggc----------------------------
Q7TS60_BCL2L2-01       -----------------cgggc----------------------------
P49950_BCL2-01         ccccttgtcgccaacgctgggcctgcgctcagccctgtgccacctgtggt
Q7TSN8_BCL2-01         cccctcgttgccaccgctgggcctgcgctcagccctgtgccacctgtggt
G3V977_BCL2A1-01       taca------------------gagagttgctttctct------------
Q925A9_BCL2A1-01       taca------------------gagagttgctttctct------------
P53563_BCL2L1-01       cacagcagcagtttggatgcgcgggaggtaatccccatggcagcagtga-
P53563_BCL2L1-02       cacagcagcagtttggatgcgcgggaggtaatccccatggcagcagtga-
P53563_BCL2L1-03       cacagcagcagtttggatgcgcgggaggtaatccccatggcagcagtga-
                                                                         

Q99M66_BCL2L10-01      ac---------------------------------agatggcgg------
Q9Z1P3_MCL1-01         tcgctgccctccacgccgccgccgcctgaggaggaagacgacgagctgta
O88996_BCL2L2-01       --------------------------------agctggagacgagtttga
Q7TS60_BCL2L2-01       --------------------------------agctggagacgagtttga
P49950_BCL2-01         cc--------------acctgaccctccgccgggctggggatgacttctc
Q7TSN8_BCL2-01         cc--------------atctgaccctccgccgggctggggatgacttctc
G3V977_BCL2A1-01       ---------------------gtacaaaaggaagttgaaaa-gaatctga
Q925A9_BCL2A1-01       ---------------------gtacaaaaggaagttgaaaa-gaatctga
P53563_BCL2L1-01       ----------------agcaagcgctgagagaggctggcgatgagtttga
P53563_BCL2L1-02       ----------------agcaagcgctgagagaggctggcgatgagtttga
P53563_BCL2L1-03       ----------------agcaagcgctgagagaggctggcgatgagtttga
                                                           *     *       

Q99M66_BCL2L10-01      --atgagttgct--------------------------------------
Q9Z1P3_MCL1-01         ccaccagtcgctggagatcatctcccgctacctgcgggagcaggcgacgg
O88996_BCL2L2-01       gacccgcttc-cggcgcac-------------------------------
Q7TS60_BCL2L2-01       gacccgcttc-cggcgcac-------------------------------
P49950_BCL2-01         tcgtcgctac-cgtcgcga-------------------------------
Q7TSN8_BCL2-01         tcgtcgctac-cgtcgtga-------------------------------
G3V977_BCL2A1-01       a--gccatacttggatgac-------------------------------
Q925A9_BCL2A1-01       a--gccatacttggatgac-------------------------------
P53563_BCL2L1-01       actgcggtac-cggagagc-------------------------------
P53563_BCL2L1-02       actgcggtac-cggagagc-------------------------------
P53563_BCL2L1-03       actgcggtac-cggagagc-------------------------------
                              *                                          

Q99M66_BCL2L10-01      -ctccaatga--ccaagagttcaactggggccg-----------------
Q9Z1P3_MCL1-01         gctccaaggacgcgaagcctctgggcgaggccggcgcagcgggccggagg
O88996_BCL2L2-01       -cttctctga----------------------------------------
Q7TS60_BCL2L2-01       -cttctctga----------------------------------------
P49950_BCL2-01         -ctttgcaga----------------------------------------
Q7TSN8_BCL2-01         -cttcgcaga----------------------------------------
G3V977_BCL2A1-01       -tttca--------------------------------------------
Q925A9_BCL2A1-01       -tttca--------------------------------------------
P53563_BCL2L1-01       -attcagtga----------------------------------------
P53563_BCL2L1-02       -attcagtga----------------------------------------
P53563_BCL2L1-03       -attcagtga----------------------------------------
                         *                                               

Q99M66_BCL2L10-01      --cctggtgatgctcc----------------------------------
Q9Z1P3_MCL1-01         gcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacga
O88996_BCL2L2-01       --cctggccgctcagctacacgtgacc-----------------ccagg-
Q7TS60_BCL2L2-01       --cctggccgctcagctacacgtgacc-----------------ccagg-
P49950_BCL2-01         --gatgtccagtcagctgcacctgacg-----------------ccctt-
Q7TSN8_BCL2-01         --gatgtccagtcagctgcacctgacg-----------------ccctt-
G3V977_BCL2A1-01       ------------------cgtggaatc-----------------cataga
Q925A9_BCL2A1-01       ------------------cgtggaatc-----------------cataga
P53563_BCL2L1-01       --tctaacatcccagcttcatataacc-----------------ccagg-
P53563_BCL2L1-02       --tctaacatcccagcttcatataacc-----------------ccagg-
P53563_BCL2L1-03       --tctaacatcccagcttcatataacc-----------------ccagg-
                                                                         

Q99M66_BCL2L10-01      --tggccttcgtggggacgctaatgaaccaagac----------aggac-
Q9Z1P3_MCL1-01         gacggccttccagggcatgcttcggaaactggacattaaaaacgaggacg
O88996_BCL2L2-01       ----ctcagcccagcaacgcttcacc------------------------
Q7TS60_BCL2L2-01       ----ctcagcccagcaacgcttcacc------------------------
P49950_BCL2-01         ----caccgcgaggggacgctttgcc------------------------
Q7TSN8_BCL2-01         ----caccgcgaggggacgctttgcc------------------------
G3V977_BCL2A1-01       tactgccagaataata----ttcaac------------------------
Q925A9_BCL2A1-01       tactgccagaataata----ttcaac------------------------
P53563_BCL2L1-01       ----gacagcatatcagagctttgaa------------------------
P53563_BCL2L1-02       ----gacagcatatcagagctttgaa------------------------
P53563_BCL2L1-03       ----gacagcatatcagagctttgaa------------------------
                             *             *                             

Q99M66_BCL2L10-01      -tgttaag---------cggaggaggga--------tcaaagaaaccgtc
Q9Z1P3_MCL1-01         atgttaaatctttttctcgagtgatgacccatgttttcaaagatggcgta
O88996_BCL2L2-01       -----------------caggtttccgacgaacttttccaagggggcccc
Q7TS60_BCL2L2-01       -----------------caggtttccgacgaacttttccaagggggcccc
P49950_BCL2-01         -----------------acggtggtggaggaactcttcagggatggggtg
Q7TSN8_BCL2-01         -----------------acggtggtggaggaactcttcagggatggggtg
G3V977_BCL2A1-01       -----------------caagtgatggaaaaagaatttgaagatggcatc
Q925A9_BCL2A1-01       -----------------caagtgatggaaaaagaatttgaagatggcatc
P53563_BCL2L1-01       -----------------caggtagtgaatgaactctttcgggatggggta
P53563_BCL2L1-02       -----------------caggtagtgaatgaactctttcgggatggggta
P53563_BCL2L1-03       -----------------caggtagtgaatgaactctttcgggatggggta
                                                           *    *        

Q99M66_BCL2L10-01      tcctactggagcgagactgcta--------tctcatagtgagcttgctgt
Q9Z1P3_MCL1-01         acaaactggggcaggattgtgactcttatttcttttggtgcctttgtggc
O88996_BCL2L2-01       ---aactggggccgtcttgtggcattctttgtctttggggc------tgc
Q7TS60_BCL2L2-01       ---aactggggccgtcttgtggcattctttgtctttggggc------tgc
P49950_BCL2-01         ---aactgggggaggattgtggccttctttgagttcggtgg------ggt
Q7TSN8_BCL2-01         ---aactgggggaggattgtggccttctttgagttcggtgg------ggt
G3V977_BCL2A1-01       attaactggggaaggattgtgactatatttgcctttg--gg------ggt
Q925A9_BCL2A1-01       attaactggggaaggattgtgactatatttgcctttg--gg------ggt
P53563_BCL2L1-01       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
P53563_BCL2L1-02       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
P53563_BCL2L1-03       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
                           ***** *      **                    *        * 

Q99M66_BCL2L10-01      ---aca----------atcgactcac------------agg---------
Q9Z1P3_MCL1-01         caaacacttaaagagcataaaccaag------------aaa---------
O88996_BCL2L2-01       cctgtgtgctgagagtgtcaacaaag------------aaatggagccat
Q7TS60_BCL2L2-01       cctgtgtgctgagagtgtcaacaaag------------aaatggagccat
P49950_BCL2-01         catgtgtgtggggagcgtcaacaggg------------agatgtcacccc
Q7TSN8_BCL2-01         catgtgtgtggagagcgtcaacaggg------------agatgtcacccc
G3V977_BCL2A1-01       gttctcctgaaaaagcttccacaagagcagattgccctggatgtggatac
Q925A9_BCL2A1-01       gttctcctgaaaaagcttccacaagagcagattggcctggatgtggatac
P53563_BCL2L1-01       actgtgcgtggaaagcgtagacaagg------------agatgcaggtat
P53563_BCL2L1-02       actgtgcgtggaaagcgtagacaagg------------agatgcaggtat
P53563_BCL2L1-03       actgtgcgtggaaagcgtagacaagg------------agatgcaggtat
                                        *  **                            

Q99M66_BCL2L10-01      -------------acggcatcgctc-------------------------
Q9Z1P3_MCL1-01         -------------gctgcatcgaacctttagcagaaagtatcacagacgt
O88996_BCL2L2-01       tggtgggacaagtgcaggat-------tggatggtgacctacctggagac
Q7TS60_BCL2L2-01       tggtgggacaagtgcaggat-------tggatggtgacctacctggagac
P49950_BCL2-01         tggtgg-------acaacatcgctctgtggatgactgagtacctgaaccg
Q7TSN8_BCL2-01         tggtgg-------acaacatcgccctgtggatgactgagtacctgaaccg
G3V977_BCL2A1-01       ttacaa-------g-caagtttccagttttgtggcggaattcataatgaa
Q925A9_BCL2A1-01       ttacaa-------g-caagtttccagttttgtggcggaattcataatgaa
P53563_BCL2L1-01       tggtga-------gtcggattgcaagttggatggccacctacctgaatga
P53563_BCL2L1-02       tggtga-------gtcggattgcaagttggatggccacctacctgaatga
P53563_BCL2L1-03       tggtga-------gtcggattgcaagttggatggccacctacctgaatga
                                          *                              

Q99M66_BCL2L10-01      ---------------------ctggctggaggctcacggtggctgg----
Q9Z1P3_MCL1-01         tcttgtaaggacgaagcgggactggcttgtgaaacaaagaggctgg----
O88996_BCL2L2-01       acgcttggctga---------ctggatccacagcagtgggggctgg----
Q7TS60_BCL2L2-01       acgcttggctga---------ctggatccacagcagtgggggctgg----
P49950_BCL2-01         gcatctgcacac---------ctggatccaggataacggaggctgg----
Q7TSN8_BCL2-01         gcatctgcacac---------ctggatccaggataacggaggctgg----
G3V977_BCL2A1-01       taacacaggaga---------atggatacagcagaatggaggctgg----
Q925A9_BCL2A1-01       taacacaggaga---------atggatacagcagaatggaggctgg----
P53563_BCL2L1-01       ccacctagagcc---------ttggatccaggagaacggcggctgg----
P53563_BCL2L1-02       ccacctagagcc---------ttggatccaggagaacggcggctgggtaa
P53563_BCL2L1-03       ccacctagagcc---------ttggatccaggagaacggcggctgggtaa
                                             *** *           * ******    

Q99M66_BCL2L10-01      ----------------------gatggcttttgccaattcttc------a
Q9Z1P3_MCL1-01         ----------------------gatgggtttgtggagttcttccacgtac
O88996_BCL2L2-01       ----------------------gcggagttcacagctctatac-------
Q7TS60_BCL2L2-01       ----------------------gcggagttcacagctctatac-------
P49950_BCL2-01         ----------------------gatgcctttgtggaactatat-------
Q7TSN8_BCL2-01         ----------------------gatgcctttgtggaactatat-------
G3V977_BCL2A1-01       -------------------------------gaagat-------------
Q925A9_BCL2A1-01       -------------------------------gaagat-------------
P53563_BCL2L1-01       ----------------------gacacttttgtggat-------------
P53563_BCL2L1-02       gaaccacgccccttgtgtgtccgccccttgtgtgtct-------------
P53563_BCL2L1-03       gaaccacgccccttgtgtgtccgccccttgtgtgtct-------------
                                                                         

Q99M66_BCL2L10-01      agaaccccttaccacccggcttctggagaagatt------gctgatccgg
Q9Z1P3_MCL1-01         aggacc---tagaaggcggcatc---agaaatgt------gctg---ctg
O88996_BCL2L2-01       ---------ggggacggggccctggaggaggcac--ggcgtctgcgggag
Q7TS60_BCL2L2-01       ---------ggggacggggccctggaggaggcac--ggcgtctgcgggag
P49950_BCL2-01         -----------------ggccccagc----atgc--gacctctgtttgat
Q7TSN8_BCL2-01         -----------------ggccccagc----atgc--gacctctgtttgat
G3V977_BCL2A1-01       -----------------ggcttcacaaagaagtttgaac--ctaaatctg
Q925A9_BCL2A1-01       -----------------ggcttcacaaagaagtttgaac--ctaaatctg
P53563_BCL2L1-01       -----------------ctctacgggaacaatgc--agcagcc-------
P53563_BCL2L1-02       -----------------ctcctctgtggagatccctaactgccctttttg
P53563_BCL2L1-03       -----------------ctcctctgtggagatccctaactgccctttttg
                                          *                     *        

Q99M66_BCL2L10-01      gctattctgtcctgtttcttt-gcaacggcc-atcttt------------
Q9Z1P3_MCL1-01         gcttttgcgg-gtgttgctggagtaggggctggtctgg------------
O88996_BCL2L2-01       gggaactggg--catcagtgaggacagtgctgacggggg-----------
Q7TS60_BCL2L2-01       gggaactggg--catcagtgaggacagtgctgacggggg-----------
P49950_BCL2-01         ttctcctggc--tgtctctgaagacgctgctcagcctgg-----------
Q7TSN8_BCL2-01         ttctcctggc--tgtctctgaagaccctgctcagcctgg-----------
G3V977_BCL2A1-01       gctggctgacttttctgcagatgacagggaagatctgggaaatgctc---
Q925A9_BCL2A1-01       gctggctgacttttctgcagatgacagggaagatctgggaaatgctc---
P53563_BCL2L1-01       --------------------gagagccggaaaggccaggag---------
P53563_BCL2L1-02       gtctcctggcatggttgttgaagatatcgattattcaggagacattcctg
P53563_BCL2L1-03       gtctcctggcatggttgttgaagatatcgattattcaggagacattcctg
                                             *     *                     

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       -------------------------------------------ctgtggc
Q7TS60_BCL2L2-01       -------------------------------------------ctgtggc
P49950_BCL2-01         -------------------------------------------ccctgg-
Q7TSN8_BCL2-01         -------------------------------------------ccctgg-
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       ----cgtttcaaccgctg-----------------------------gtt
P53563_BCL2L1-02       gcttcactttaataccaggggttaactttgggaatattgatgaccctgtt
P53563_BCL2L1-03       gcttcactttaataccaggggttaactttgggaatattgatgaccctgtt
                                                                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       actgggggccctg-----gtaactgtaggggccttt--------------
Q7TS60_BCL2L2-01       actgggggccctg-----gtaactgtaggggccttt--------------
P49950_BCL2-01         --tgggggcctgc-----atcactctgggtgcatac--------------
Q7TSN8_BCL2-01         --tcggggcctgc-----atcactctgggtgcatac--------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       cctgacgggcatg--------actgtggctg-----gtg-----------
P53563_BCL2L1-02       tttaaggaacctgtatttttcattctggctacccttgtggccccgcagtt
P53563_BCL2L1-03       tttaaggaacctgtatttttcattctggctacccttgtggccccgcagtt
                                                                         

Q99M66_BCL2L10-01      -----------------tatatctggaaatgtttataa------------
Q9Z1P3_MCL1-01         -----------------catatctaataagg----tag------------
O88996_BCL2L2-01       -----------------tttgctagcaagtga------------------
Q7TS60_BCL2L2-01       -----------------tttgctagcaagtga------------------
P49950_BCL2-01         -----------------ctgggccacaagtga------------------
Q7TSN8_BCL2-01         -----------------ctgggccacaagtga------------------
G3V977_BCL2A1-01       -----------------tttctcctcaagcaacacta-------------
Q925A9_BCL2A1-01       -----------------tttctcctcaagcaacacta-------------
P53563_BCL2L1-01       ---tagttctgctgggctcactcttcagtcggaagtga------------
P53563_BCL2L1-02       tcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtgttta
P53563_BCL2L1-03       tcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtgttta
                                                                         

Q99M66_BCL2L10-01      -----------------
Q9Z1P3_MCL1-01         -----------------
O88996_BCL2L2-01       -----------------
Q7TS60_BCL2L2-01       -----------------
P49950_BCL2-01         -----------------
Q7TSN8_BCL2-01         -----------------
G3V977_BCL2A1-01       -------------ctga
Q925A9_BCL2A1-01       -------------ctga
P53563_BCL2L1-01       -----------------
P53563_BCL2L1-02       cttggcttaaaacctag
P53563_BCL2L1-03       cttggcttaaaacctag
                                        

© 1998-2022Legal notice