Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
P53563_BCL2L1-04       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ----------------------------atg-------------------
Q9Z1P3_MCL1-01         ----------------------------atgtttggccttcggagaaacg
G3V977_BCL2A1-01       ----------------------------atg-------------------
Q925A9_BCL2A1-01       ----------------------------atg-------------------
O88996_BCL2L2-01       ----------------------------atg-------------------
Q7TS60_BCL2L2-01       gtcatccttgcccctttcagccgcccggatg-------------------
Q7TSN8_BCL2-01         ----------------------------atg-------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ----------------------------atg-------------------
P49950_BCL2-01         ----------------------------atg-------------------
P53563_BCL2L1-01       ----------------------------atg-------------------
P53563_BCL2L1-02       ----------------------------atg-------------------
P53563_BCL2L1-03       ----------------------------atg-------------------
P53563_BCL2L1-04       ----------------------------atg-------------------
                                                                         

Q99M66_BCL2L10-01      -ggtgacccgct--------------------------------------
Q9Z1P3_MCL1-01         cggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggc
G3V977_BCL2A1-01       ---------ac--agactgtgagttc------------------------
Q925A9_BCL2A1-01       ---------ac--agactgtgagttc------------------------
O88996_BCL2L2-01       ---------gc---gaccccagcctc------------------------
Q7TS60_BCL2L2-01       ---------gc---gaccccagcctc------------------------
Q7TSN8_BCL2-01         ---------gcgcaagccgggagaac------------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ---------gcgcaagccgggagaac------------------------
P49950_BCL2-01         ---------gcgcaagccgggagaac------------------------
P53563_BCL2L1-01       ---------tctcagagc--------------------------------
P53563_BCL2L1-02       ---------tctcagagc--------------------------------
P53563_BCL2L1-03       ---------tctcagagc--------------------------------
P53563_BCL2L1-04       ---------tctcagagc--------------------------------
                                                                         

Q99M66_BCL2L10-01      ------------gcaggatcgcactagacggctgctgactgacta-----
Q9Z1P3_MCL1-01         ggcggctctccggccgggacgcgcctggcggccgagga--ggccaaggcg
G3V977_BCL2A1-01       ------------atgt----atatccactccctggctgagaacta-----
Q925A9_BCL2A1-01       ------------atgt----atatccactccctggctgagaacta-----
O88996_BCL2L2-01       ------------aaccccagacacacgggctctagtggctgactt-----
Q7TS60_BCL2L2-01       ------------aaccccagacacacgggctctagtggctgactt-----
Q7TSN8_BCL2-01         ------------agggtatgataaccgggagatcgtgatgaagta-----
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ------------agggtatgataaccgggagatcgtgatgaagta-----
P49950_BCL2-01         ------------agggtatgataaccgggagatcgtgatgaagta-----
P53563_BCL2L1-01       ----------------------aaccgggagctggtggttgactt-----
P53563_BCL2L1-02       ----------------------aaccgggagctggtggttgactt-----
P53563_BCL2L1-03       ----------------------aaccgggagctggtggttgactt-----
P53563_BCL2L1-04       ----------------------aaccgggagctggtggttgactt-----
                                                                         

Q99M66_BCL2L10-01      --------------------------catattgttctgcgcac-------
Q9Z1P3_MCL1-01         cggcgcgaggggggaggggaggccgctctgctgcccggcgcgcgggtggt
G3V977_BCL2A1-01       -------------------------------tcttcagtatgt-------
Q925A9_BCL2A1-01       -------------------------------tcttcagtatgt-------
O88996_BCL2L2-01       -------------------------------tgtaggctataa-------
Q7TS60_BCL2L2-01       -------------------------------tgtaggctataa-------
Q7TSN8_BCL2-01         -------------------------------catacattataa-------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         -------------------------------catccattataa-------
P49950_BCL2-01         -------------------------------catccattataa-------
P53563_BCL2L1-01       -------------------------------tctctcctacaa-------
P53563_BCL2L1-02       -------------------------------tctctcctacaa-------
P53563_BCL2L1-03       -------------------------------tctctcctacaa-------
P53563_BCL2L1-04       -------------------------------tctctcctacaa-------
                                                                         

Q99M66_BCL2L10-01      ------------------gggcgccgaacacccctgagccactgccc---
Q9Z1P3_MCL1-01         cgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcgg
G3V977_BCL2A1-01       ----------------------------------------cct------g
Q925A9_BCL2A1-01       ----------------------------------------cct------g
O88996_BCL2L2-01       ----------------------------------------gctgaggcag
Q7TS60_BCL2L2-01       ----------------------------------------gctgaggcag
Q7TSN8_BCL2-01         ----------------------------------------gctgtcacag
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ----------------------------------------gctgtcacag
P49950_BCL2-01         ----------------------------------------gctgtcacag
P53563_BCL2L1-01       ----------------------------------------gctctcccag
P53563_BCL2L1-02       ----------------------------------------gctctcccag
P53563_BCL2L1-03       ----------------------------------------gctctcccag
P53563_BCL2L1-04       ----------------------------------------gctctcccag
                                                                         

Q99M66_BCL2L10-01      -------acgtctgttga--------ggcggccttgctgcgctctgtgac
Q9Z1P3_MCL1-01         cagagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgag
G3V977_BCL2A1-01       caggtacctgccttt-----------------------------------
Q925A9_BCL2A1-01       caggtacctgccttt-----------------------------------
O88996_BCL2L2-01       aagggttatgtctgt-----------------------ggagctgg----
Q7TS60_BCL2L2-01       aagggttatgtctgt-----------------------ggagctgg----
Q7TSN8_BCL2-01         aggggctacgagtgg-----------------------gatgctggagat
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         aggggctacgagtgg-----------------------gatactggagat
P49950_BCL2-01         aggggctacgagtgg-----------------------gatactggagat
P53563_BCL2L1-01       aaaggatacagctgg-----------agtcagtttagcgatgtcgaagag
P53563_BCL2L1-02       aaaggatacagctgg-----------agtcagtttagcgatgtcgaagag
P53563_BCL2L1-03       aaaggatacagctgg-----------agtcagtttagcgatgtcgaagag
P53563_BCL2L1-04       aaaggatacagctgg-----------agtcagtttagcgatgtcgaagag
                                                                         

Q99M66_BCL2L10-01      tag----------------------tcagatcc----aacaggagc----
Q9Z1P3_MCL1-01         gagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
G3V977_BCL2A1-01       ----------------------gaatcggctccaagcaaaacg-------
Q925A9_BCL2A1-01       ----------------------gaatcggctccaagcaaaacg-------
O88996_BCL2L2-01       -------------------------------ccctggggaagg-------
Q7TS60_BCL2L2-01       -------------------------------ccctggggaagg-------
Q7TSN8_BCL2-01         ------------------gcggacgcggcgcccctgggggctg-------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ------------------gaagactccgcgcccctgagggctg-------
P49950_BCL2-01         ------------------gaagactccgcgcccctgagggctg-------
P53563_BCL2L1-01       aacaggactgaagccccagaagaaactgaaccagaaagggaga-------
P53563_BCL2L1-02       aacaggactgaagccccagaagaaactgaaccagaaagggaga-------
P53563_BCL2L1-03       aacaggactgaagccccagaagaaactgaaccagaaagggaga-------
P53563_BCL2L1-04       aacaggactgaagccccagaagaaactgaaccagaaagggaga-------
                                                                         

Q99M66_BCL2L10-01      --------accaggatcttttcaac-------------tccttccgcgac
Q9Z1P3_MCL1-01         cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctac
G3V977_BCL2A1-01       -------------------------------------------tccagag
Q925A9_BCL2A1-01       -------------------------------------------tccagag
O88996_BCL2L2-01       -------------------------------------------ccc----
Q7TS60_BCL2L2-01       -------------------------------------------ccc----
Q7TSN8_BCL2-01         -------------------------------------------ccc----
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         -------------------------------------------ccc----
P49950_BCL2-01         -------------------------------------------ccc----
P53563_BCL2L1-01       -------------------------------------------cccccag
P53563_BCL2L1-02       -------------------------------------------cccccag
P53563_BCL2L1-03       -------------------------------------------cccccag
P53563_BCL2L1-04       -------------------------------------------cccccag
                                                                         

Q99M66_BCL2L10-01      t----------accagggcaaccg-----cctggagctggtga---cac-
Q9Z1P3_MCL1-01         tggagcgcgtgagcgaggcggctaagagctccggagctgacgg---ctcg
G3V977_BCL2A1-01       tgcta------------------------cagagagttgct-----ttct
Q925A9_BCL2A1-01       tgcta------------------------cagagagttgct-----ttct
O88996_BCL2L2-01       ----------------------------------agcagccga---cccg
Q7TS60_BCL2L2-01       ----------------------------------agcagccga---cccg
Q7TSN8_BCL2-01         --ccacccctggcatcttctccttccagcctgagagcaacccaatgcccg
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         --ccacccctggcatcttctccttccagcctgagagcaaccggacgcccg
P49950_BCL2-01         --ccacccctggcatcttctccttccagcctgagagcaaccgaacgcccg
P53563_BCL2L1-01       tgccatcaatggcaacccatcctggcacctggcggatagc------cccg
P53563_BCL2L1-02       tgccatcaatggcaacccatcctggcacctggcggatagc------cccg
P53563_BCL2L1-03       tgccatcaatggcaacccatcctggcacctggcggatagc------cccg
P53563_BCL2L1-04       tgccatcaatggcaacccatcctggcacctggcggatagc------cccg
                                                                         

Q99M66_BCL2L10-01      --------------------------------agatggcgg--------a
Q9Z1P3_MCL1-01         ctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtacca
G3V977_BCL2A1-01       ctgtacaaaaggaagttg--------------------------------
Q925A9_BCL2A1-01       ctgtacaaaaggaagttg--------------------------------
O88996_BCL2L2-01       ctgc----------------------------------------------
Q7TS60_BCL2L2-01       ctgc----------------------------------------------
Q7TSN8_BCL2-01         ctgtgcaccgggacatggctgccaggacgtctcctctcagg---------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ctgtgcaccgagacacggctgccaggacgtcgcctctacgg---------
P49950_BCL2-01         ctgtgcaccgagacacggctgccaggacgtcgcctctacgg---------
P53563_BCL2L1-01       cggtgaatggagccactg-------------gccacagcag---------
P53563_BCL2L1-02       cggtgaatggagccactg-------------gccacagcag---------
P53563_BCL2L1-03       cggtgaatggagccactg-------------gccacagcag---------
P53563_BCL2L1-04       cggtgaatggagccactg-------------gccacagcag---------
                                                                         

Q99M66_BCL2L10-01      tgagttgct---------------------------------------ct
Q9Z1P3_MCL1-01         ccagtcgctggagatcatctcccgctacctgcgggagcaggcgacgggct
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         -------------------------------------------------c
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         -------------------------------------------------c
P49950_BCL2-01         -------------------------------------------------c
P53563_BCL2L1-01       -------------------------------------------------c
P53563_BCL2L1-02       -------------------------------------------------c
P53563_BCL2L1-03       -------------------------------------------------c
P53563_BCL2L1-04       -------------------------------------------------c
                                                                         

Q99M66_BCL2L10-01      ccaatga--ccaagagttcaactggggccg-------------------c
Q9Z1P3_MCL1-01         ccaaggacgcgaagcctctgggcgaggccggcgcagcgggccggagggcg
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         ccctcgttgccaccgctgggcctgcgctcagccctgtgccacctgtggtc
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         cccttgtcgccaccgctgggcctgcgctcagccctgtgccacctgtggtc
P49950_BCL2-01         cccttgtcgccaacgctgggcctgcgctcagccctgtgccacctgtggtc
P53563_BCL2L1-01       agtttg--------gatgcgcgggaggtaatccccatggcagcagtga--
P53563_BCL2L1-02       agtttg--------gatgcgcgggaggtaatccccatggcagcagtga--
P53563_BCL2L1-03       agtttg--------gatgcgcgggaggtaatccccatggcagcagtga--
P53563_BCL2L1-04       agtttg--------gatgcgcgggaggtaatccccatggcagcagtga--
                                                                         

Q99M66_BCL2L10-01      ctggtgatgctcc------------------------------------t
Q9Z1P3_MCL1-01         ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagac
G3V977_BCL2A1-01       -aaaagaatctgaagccatacttggatgacttt-----------------
Q925A9_BCL2A1-01       -aaaagaatctgaagccatacttggatgacttt-----------------
O88996_BCL2L2-01       -accaagccatgcgggcagctggagacgagtttgagacccgcttccggcg
Q7TS60_BCL2L2-01       -accaagccatgcgggcagctggagacgagtttgagacccgcttccggcg
Q7TSN8_BCL2-01         catctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         cacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
P49950_BCL2-01         cacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
P53563_BCL2L1-01       -agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggag
P53563_BCL2L1-02       -agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggag
P53563_BCL2L1-03       -agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggag
P53563_BCL2L1-04       -agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggag
                                                                         

Q99M66_BCL2L10-01      ggccttcgtggggacgctaatgaaccaagac----------aggac--tg
Q9Z1P3_MCL1-01         ggccttccagggcatgcttcggaaactggacattaaaaacgaggacgatg
G3V977_BCL2A1-01       ----------------------------cacgtggaatccatagatactg
Q925A9_BCL2A1-01       ----------------------------cacgtggaatccatagatactg
O88996_BCL2L2-01       caccttctctgacctggccgctcagctacacgtga---ccccaggctcag
Q7TS60_BCL2L2-01       caccttctctgacctggccgctcagctacacgtga---ccccaggctcag
Q7TSN8_BCL2-01         tgacttcgcagagatgtccagtcagctgcacctga---cgcccttcaccg
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         cgactttgcagagatgtccagtcagctgcacctga---cgcccttcaccg
P49950_BCL2-01         cgactttgcagagatgtccagtcagctgcacctga---cgcccttcaccg
P53563_BCL2L1-01       agcattcagtgatctaacatcccagcttcatataa---ccccagggacag
P53563_BCL2L1-02       agcattcagtgatctaacatcccagcttcatataa---ccccagggacag
P53563_BCL2L1-03       agcattcagtgatctaacatcccagcttcatataa---ccccagggacag
P53563_BCL2L1-04       agcattcagtgatctaacatcccagcttcatataa---ccccagggacag
                                                                         

Q99M66_BCL2L10-01      ttaa---g---------cggaggaggga--------tcaaagaaaccgtc
Q9Z1P3_MCL1-01         ttaa---atctttttctcgagtgatgacccatgttttcaaagatggcgta
G3V977_BCL2A1-01       ccagaataatattcaaccaagtgatggaaaaagaatttgaagatggcatc
Q925A9_BCL2A1-01       ccagaataatattcaaccaagtgatggaaaaagaatttgaagatggcatc
O88996_BCL2L2-01       cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
Q7TS60_BCL2L2-01       cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
Q7TSN8_BCL2-01         cgaggggacgctttgccacggtggtggaggaactcttcagggatggggtg
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         cgaggggacgctttgccacggtggtggaggaactcttcagggatggggtg
P49950_BCL2-01         cgaggggacgctttgccacggtggtggaggaactcttcagggatggggtg
P53563_BCL2L1-01       catatcagagctttgaacaggtagtgaatgaactctttcgggatggggta
P53563_BCL2L1-02       catatcagagctttgaacaggtagtgaatgaactctttcgggatggggta
P53563_BCL2L1-03       catatcagagctttgaacaggtagtgaatgaactctttcgggatggggta
P53563_BCL2L1-04       catatcagagctttgaacaggtagtgaatgaactctttcgggatggggta
                                                                         

Q99M66_BCL2L10-01      tcctactggagcgagactgcta--------tctcatagtgagcttgctgt
Q9Z1P3_MCL1-01         acaaactggggcaggattgtgactcttatttcttttggtgcctttgtggc
G3V977_BCL2A1-01       attaactggggaaggattgtgactatatttgcctttggggg------tgt
Q925A9_BCL2A1-01       attaactggggaaggattgtgactatatttgcctttggggg------tgt
O88996_BCL2L2-01       ---aactggggccgtcttgtggcattctttgtctttggggc------tgc
Q7TS60_BCL2L2-01       ---aactggggccgtcttgtggcattctttgtctttggggc------tgc
Q7TSN8_BCL2-01         ---aactgggggaggattgtggccttctttgagttcggtgg------ggt
F1LNV0_BCL2-02         ----------------ttgtggccttctttgagttcggtgg------ggt
F1LNV0_BCL2-01         ---aactgggggaggattgtggccttctttgagttcggtgg------ggt
P49950_BCL2-01         ---aactgggggaggattgtggccttctttgagttcggtgg------ggt
P53563_BCL2L1-01       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
P53563_BCL2L1-02       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
P53563_BCL2L1-03       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
P53563_BCL2L1-04       ---aactggggtcgcattgtggccttcttctcctttggcgg------ggc
                                        **                  * *        * 

Q99M66_BCL2L10-01      ---aca----------atcgactcacag----------------------
Q9Z1P3_MCL1-01         caaacacttaaagagcataaaccaagaa----------------------
G3V977_BCL2A1-01       --tctcctgaaaaagcttccacaagagcagattgccctggatgtggatac
Q925A9_BCL2A1-01       --tctcctgaaaaagcttccacaagagcagattggcctggatgtggatac
O88996_BCL2L2-01       cctgtgtgctgagagtgtcaacaaagaaatggagccattggtg-------
Q7TS60_BCL2L2-01       cctgtgtgctgagagtgtcaacaaagaaatggagccattggtg-------
Q7TSN8_BCL2-01         catgtgtgtggagagcgtcaacagggagatgtcacccctggtg-------
F1LNV0_BCL2-02         catgtgtgtggagagcgtcaacagggagatgtcacccctggtg-------
F1LNV0_BCL2-01         catgtgtgtggagagcgtcaacagggagatgtcacccctggtg-------
P49950_BCL2-01         catgtgtgtggggagcgtcaacagggagatgtcacccctggtg-------
P53563_BCL2L1-01       actgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-------
P53563_BCL2L1-02       actgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-------
P53563_BCL2L1-03       actgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-------
P53563_BCL2L1-04       actgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-------
                                        *  **                            

Q99M66_BCL2L10-01      ----gacggcatcgctc---------------------------------
Q9Z1P3_MCL1-01         ----agctgcatcgaacctttagcagaaagtatcacagacgttcttgtaa
G3V977_BCL2A1-01       ttacaagcaagtttccagttttgtggcggaattcataatgaataacacag
Q925A9_BCL2A1-01       ttacaagcaagtttccagttttgtggcggaattcataatgaataacacag
O88996_BCL2L2-01       ----ggacaagtgcaggattggatggtgacctacctggagacacgcttgg
Q7TS60_BCL2L2-01       ----ggacaagtgcaggattggatggtgacctacctggagacacgcttgg
Q7TSN8_BCL2-01         ----gacaacatcgccctgtggatgactgagtacctgaaccggcatctgc
F1LNV0_BCL2-02         ----gacaacatcgctctgtggatgactgagtacctgaaccggcatctgc
F1LNV0_BCL2-01         ----gacaacatcgctctgtggatgactgagtacctgaaccggcatctgc
P49950_BCL2-01         ----gacaacatcgctctgtggatgactgagtacctgaaccggcatctgc
P53563_BCL2L1-01       ----agtcggattgcaagttggatggccacctacctgaatgaccacctag
P53563_BCL2L1-02       ----agtcggattgcaagttggatggccacctacctgaatgaccacctag
P53563_BCL2L1-03       ----agtcggattgcaagttggatggccacctacctgaatgaccacctag
P53563_BCL2L1-04       ----agtcggattgcaagttggatggccacctacctgaatgaccacctag
                                  *                                      

Q99M66_BCL2L10-01      -------------ctggctggaggctcacggtggctgggatg--------
Q9Z1P3_MCL1-01         ggacgaagcgggactggcttgtgaaacaaagaggctgggatg--------
G3V977_BCL2A1-01       gaga---------atggatacagcagaatggaggctgggaag--------
Q925A9_BCL2A1-01       gaga---------atggatacagcagaatggaggctgggaag--------
O88996_BCL2L2-01       ctga---------ctggatccacagcagtgggggctgggcgg--------
Q7TS60_BCL2L2-01       ctga---------ctggatccacagcagtgggggctgggcgg--------
Q7TSN8_BCL2-01         acac---------ctggatccaggataacggaggctgggatg--------
F1LNV0_BCL2-02         acac---------ctggatccaggataacggaggctggg-----------
F1LNV0_BCL2-01         acac---------ctggatccaggataacggaggctgggatg--------
P49950_BCL2-01         acac---------ctggatccaggataacggaggctgggatg--------
P53563_BCL2L1-01       agcc---------ttggatccaggagaacggcggctgggaca--------
P53563_BCL2L1-02       agcc---------ttggatccaggagaacggcggctgggtaagaaccacg
P53563_BCL2L1-03       agcc---------ttggatccaggagaacggcggctgggtaagaaccacg
P53563_BCL2L1-04       agcc---------ttggatccaggagaacggcggctgggtaagaaccacg
                                     *** *           * *******           

Q99M66_BCL2L10-01      ----------------gcttttgccaattct-------------------
Q9Z1P3_MCL1-01         ----------------ggtttgtggagttct-------------------
G3V977_BCL2A1-01       ---------------------atggcttcacaaagaagtt----------
Q925A9_BCL2A1-01       ---------------------atggcttcacaaagaagtt----------
O88996_BCL2L2-01       ----------------agttcacagctctatacggggacggggccctgga
Q7TS60_BCL2L2-01       ----------------agttcacagctctatacggggacggggccctgga
Q7TSN8_BCL2-01         ----------------cctttgtggaactat-------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         ----------------cctttgtggaactat-------------------
P49950_BCL2-01         ----------------cctttgtggaactat-------------------
P53563_BCL2L1-01       ----------------cttttgtggatctctacgggaacaatgcagcagc
P53563_BCL2L1-02       ccccttgtgtgtccgccccttgtgtgtctct------------cctctgt
P53563_BCL2L1-03       ccccttgtgtgtccgccccttgtgtgtctct------------cctctgt
P53563_BCL2L1-04       ccccttgtgtgtccgccccttgtgtgtctct------------cctctgt
                                                                         

Q99M66_BCL2L10-01      -------------------------tc------aagaaccccttaccacc
Q9Z1P3_MCL1-01         -------------------------tccacgtacaggacc---tagaagg
G3V977_BCL2A1-01       ----------------------------------tgaacctaaatctggc
Q925A9_BCL2A1-01       ----------------------------------tgaacctaaatctggc
O88996_BCL2L2-01       ggaggcacggcgtctgcgggag----------------------gggaac
Q7TS60_BCL2L2-01       ggaggcacggcgtctgcgggag----------------------gggaac
Q7TSN8_BCL2-01         --atggccccagcatgcgacctctgtt-------tgatttc------tcc
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         --atggccccagcatgcgacctctgtt-------tgatttc------tcc
P49950_BCL2-01         --atggccccagcatgcgacctctgtt-------tgatttc------tcc
P53563_BCL2L1-01       cgagagccggaaaggccaggagcgtttcaaccgctggttcctgacgggca
P53563_BCL2L1-02       ggagatccctaactgcc-----ctttt-------tggtctc---ctggca
P53563_BCL2L1-03       ggagatccctaactgcc-----ctttt-------tggtctc---ctggca
P53563_BCL2L1-04       ggagatccctaactgcc-----ctttt-------tggtctc---ctggca
                                                                         

Q99M66_BCL2L10-01      cggcttctg--------gagaagattgctgatccgggctat-----tctg
Q9Z1P3_MCL1-01         cggcatc-----------agaaatgtgctg---ctggcttt-----tgcg
G3V977_BCL2A1-01       tggctgacttttctgcagatgacagggaagatctgggaaatgc-------
Q925A9_BCL2A1-01       tggctgacttttctgcagatgacagggaagatctgggaaatgc-------
O88996_BCL2L2-01       tgggcatcagt------gaggacagtgctgacgggggctgtggcactggg
Q7TS60_BCL2L2-01       tgggcatcagt------gaggacagtgctgacgggggctgtggcactggg
Q7TSN8_BCL2-01         tggctgtctct------gaagaccctgctcagcctggccctgg---tcgg
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         tggctgtctct------gaagacgctgctcagcctggccctgg---tggg
P49950_BCL2-01         tggctgtctct------gaagacgctgctcagcctggccctgg---tggg
P53563_BCL2L1-01       tgactgt---g------gctggtgtagtt-------------c---tg--
P53563_BCL2L1-02       tggttgt---t------gaagatatcgattattcaggagacat---tc--
P53563_BCL2L1-03       tggttgt---t------gaagatatcgattattcaggagacat---tc--
P53563_BCL2L1-04       tggttgt---t------gaagatatcgattattcaggagacat---tc--
                                                                         

Q99M66_BCL2L10-01      tcctgtttcttt-gcaacggcc-atcttttatatctggaaatgtttataa
Q9Z1P3_MCL1-01         g-gtgttgctggagtaggggctggtctggcatatctaataagg----tag
G3V977_BCL2A1-01       ------------------------tctttctcctcaagcaacactactga
Q925A9_BCL2A1-01       ------------------------tctttctcctcaagcaacactactga
O88996_BCL2L2-01       ggccctggtaactgtaggggcc-ttttttgctagcaagtga---------
Q7TS60_BCL2L2-01       ggccctggtaactgtaggggcc-ttttttgctagcaagtga---------
Q7TSN8_BCL2-01         ggcctgcatcactctgggtgca-tacctgggccacaagtga---------
F1LNV0_BCL2-02         --------------taggtgca-tgtctggt---tgaatga---------
F1LNV0_BCL2-01         ggcctgcatcactctgggtgca-tacctgggccacaagtga---------
P49950_BCL2-01         ggcctgcatcactctgggtgca-tacctgggccacaagtga---------
P53563_BCL2L1-01       -------------ctgggctca-ctcttcagtcggaagtga---------
P53563_BCL2L1-02       -------------ctggcttca-ctttaataccaggggttaactttggga
P53563_BCL2L1-03       -------------ctggcttca-ctttaataccaggggttaactttggga
P53563_BCL2L1-04       -------------ctggc-tca-ctttaa---------------------
                                                                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       atattgatgaccctgtttttaaggaacctgtatttttcattctggctacc
P53563_BCL2L1-03       atattgatgaccctgtttttaaggaacctgtatttttcattctggctacc
P53563_BCL2L1-04       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-02         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       cttgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaa
P53563_BCL2L1-03       cttgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaa
P53563_BCL2L1-04       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ----------------------------------
Q9Z1P3_MCL1-01         ----------------------------------
G3V977_BCL2A1-01       ----------------------------------
Q925A9_BCL2A1-01       ----------------------------------
O88996_BCL2L2-01       ----------------------------------
Q7TS60_BCL2L2-01       ----------------------------------
Q7TSN8_BCL2-01         ----------------------------------
F1LNV0_BCL2-02         ----------------------------------
F1LNV0_BCL2-01         ----------------------------------
P49950_BCL2-01         ----------------------------------
P53563_BCL2L1-01       ----------------------------------
P53563_BCL2L1-02       aacagcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-03       aacagcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-04       ----------------------------------
                                                         

© 1998-2022Legal notice