Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ----------------------------atg-------------------
Q9Z1P3_MCL1-01         ----------------------------atgtttggccttcggagaaacg
O88996_BCL2L2-01       ----------------------------atg-------------------
Q7TS60_BCL2L2-01       gtcatccttgcccctttcagccgcccggatg-------------------
Q7TSN8_BCL2-01         ----------------------------atg-------------------
F1LNV0_BCL2-01         ----------------------------atg-------------------
P49950_BCL2-01         ----------------------------atg-------------------
G3V977_BCL2A1-01       ----------------------------atg-------------------
Q925A9_BCL2A1-01       ----------------------------atg-------------------
P53563_BCL2L1-01       ----------------------------atg-------------------
P53563_BCL2L1-02       ----------------------------atg-------------------
P53563_BCL2L1-03       ----------------------------atg-------------------
                                                   ***                   

Q99M66_BCL2L10-01      -ggtgacccgct--------------------------------------
Q9Z1P3_MCL1-01         cggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggc
O88996_BCL2L2-01       ------------------------------------------gcgacccc
Q7TS60_BCL2L2-01       ------------------------------------------gcgacccc
Q7TSN8_BCL2-01         ------------------------------------------gcg---ca
F1LNV0_BCL2-01         ------------------------------------------gcg---ca
P49950_BCL2-01         ------------------------------------------gcg---ca
G3V977_BCL2A1-01       ------------------------------------------ac------
Q925A9_BCL2A1-01       ------------------------------------------ac------
P53563_BCL2L1-01       ------------------------------------------tct-----
P53563_BCL2L1-02       ------------------------------------------tct-----
P53563_BCL2L1-03       ------------------------------------------tct-----
                                                                         

Q99M66_BCL2L10-01      ------------gcaggatcgcactagacggctgctgactgacta-----
Q9Z1P3_MCL1-01         ggcggctctccggccgggacgcgcctggcggccgagga--ggccaaggcg
O88996_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactt-----
Q7TS60_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactt-----
Q7TSN8_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagta-----
F1LNV0_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagta-----
P49950_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagta-----
G3V977_BCL2A1-01       ---------------------agactgtgagttcatg-------------
Q925A9_BCL2A1-01       ---------------------agactgtgagttcatg-------------
P53563_BCL2L1-01       ----------------cagagcaaccgggagctggtggttgactt-----
P53563_BCL2L1-02       ----------------cagagcaaccgggagctggtggttgactt-----
P53563_BCL2L1-03       ----------------cagagcaaccgggagctggtggttgactt-----
                                                 *         *             

Q99M66_BCL2L10-01      --------------------------catattgttctgcgcac-------
Q9Z1P3_MCL1-01         cggcgcgaggggggaggggaggccgctctgctgcccggcgcgcgggtggt
O88996_BCL2L2-01       -------------------tgtaggctataagctgaggcagaagggttat
Q7TS60_BCL2L2-01       -------------------tgtaggctataagctgaggcagaagggttat
Q7TSN8_BCL2-01         -------------------catacattataagctgtcacagaggggctac
F1LNV0_BCL2-01         -------------------catccattataagctgtcacagaggggctac
P49950_BCL2-01         -------------------catccattataagctgtcacagaggggctac
G3V977_BCL2A1-01       --------------------------tatatccactccctg---------
Q925A9_BCL2A1-01       --------------------------tatatccactccctg---------
P53563_BCL2L1-01       -------------------tctctcctacaagctctcccagaaaggatac
P53563_BCL2L1-02       -------------------tctctcctacaagctctcccagaaaggatac
P53563_BCL2L1-03       -------------------tctctcctacaagctctcccagaaaggatac
                                                             *           

Q99M66_BCL2L10-01      ------------------gggcgccgaacacccctgagccactgccc---
Q9Z1P3_MCL1-01         cgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcgg
O88996_BCL2L2-01       gtctg-------------tggagctgg-----------------ccctgg
Q7TS60_BCL2L2-01       gtctg-------------tggagctgg-----------------ccctgg
Q7TSN8_BCL2-01         gagtg-------------ggatgctggagatgcggacgcggcgcccctgg
F1LNV0_BCL2-01         gagtg-------------ggatactggagatgaagactccgcgcccctga
P49950_BCL2-01         gagtg-------------ggatactggagatgaagactccgcgcccctga
G3V977_BCL2A1-01       -gctgagaactatcttcagtatgtc-------------ctgcag------
Q925A9_BCL2A1-01       -gctgagaactatcttcagtatgtc-------------ctgcag------
P53563_BCL2L1-01       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
P53563_BCL2L1-02       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
P53563_BCL2L1-03       agctg-gagtcagtttagcgatgtcgaagagaacaggactgaagccccag
                                                                         

Q99M66_BCL2L10-01      -------acgtctgttga--------ggcggccttgctgcgctctgtgac
Q9Z1P3_MCL1-01         cagagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgag
O88996_BCL2L2-01       ggaa-----------------------------------ggccc------
Q7TS60_BCL2L2-01       ggaa-----------------------------------ggccc------
Q7TSN8_BCL2-01         gggc-----------------------------------tgcccccaccc
F1LNV0_BCL2-01         gggc-----------------------------------tgcccccaccc
P49950_BCL2-01         gggc-----------------------------------tgcccccaccc
G3V977_BCL2A1-01       --------gtacc--------------------------tgcctttga--
Q925A9_BCL2A1-01       --------gtacc--------------------------tgcctttga--
P53563_BCL2L1-01       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
P53563_BCL2L1-02       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
P53563_BCL2L1-03       aagaaactgaaccagaaa--------gggagacccccagtgccatcaatg
                                                               **        

Q99M66_BCL2L10-01      tag----------------------tcagatcc----aacaggagc----
Q9Z1P3_MCL1-01         gagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
O88996_BCL2L2-01       ------------------------------------------------ag
Q7TS60_BCL2L2-01       ------------------------------------------------ag
Q7TSN8_BCL2-01         ctg----------------------gcatcttctccttccagcctgagag
F1LNV0_BCL2-01         ctg----------------------gcatcttctccttccagcctgagag
P49950_BCL2-01         ctg----------------------gcatcttctccttccagcctgagag
G3V977_BCL2A1-01       -----------------------------atc--ggctccaagcaaaacg
Q925A9_BCL2A1-01       -----------------------------atc--ggctccaagcaaaacg
P53563_BCL2L1-01       gca----------------------acccatcctggcacctggcggatag
P53563_BCL2L1-02       gca----------------------acccatcctggcacctggcggatag
P53563_BCL2L1-03       gca----------------------acccatcctggcacctggcggatag
                                                                         

Q99M66_BCL2L10-01      --------accaggatcttttcaac-------------tccttccgcgac
Q9Z1P3_MCL1-01         cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctac
O88996_BCL2L2-01       cagccga---cccgc--tgcaccaagccatg-------------------
Q7TS60_BCL2L2-01       cagccga---cccgc--tgcaccaagccatg-------------------
Q7TSN8_BCL2-01         caacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctc
F1LNV0_BCL2-01         caaccggacgcccgctgtgcaccgagacacggctgccaggacgtcgcctc
P49950_BCL2-01         caaccgaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctc
G3V977_BCL2A1-01       t---------ccagag----------------------------------
Q925A9_BCL2A1-01       t---------ccagag----------------------------------
P53563_BCL2L1-01       c---------cccgcggtgaatggagccact-------------------
P53563_BCL2L1-02       c---------cccgcggtgaatggagccact-------------------
P53563_BCL2L1-03       c---------cccgcggtgaatggagccact-------------------
                                 *  *                                    

Q99M66_BCL2L10-01      t----------accagggcaaccg-----cctggagctggtgacac----
Q9Z1P3_MCL1-01         tggagcgcgtgagcgaggcggctaagagctccggagctgacggctcgctg
O88996_BCL2L2-01       ----------------------cggg----c-------------------
Q7TS60_BCL2L2-01       ----------------------cggg----c-------------------
Q7TSN8_BCL2-01         tcaggcccctcgttgccaccgctggg----cctgcgctcag--ccctgtg
F1LNV0_BCL2-01         tacggccccttgtcgccaccgctggg----cctgcgctcag--ccctgtg
P49950_BCL2-01         tacggccccttgtcgccaacgctggg----cctgcgctcag--ccctgtg
G3V977_BCL2A1-01       --tgctaca----------------------gagagttgct--ttctct-
Q925A9_BCL2A1-01       --tgctaca----------------------gagagttgct--ttctct-
P53563_BCL2L1-01       --ggccacagcagcagtttggatgcg----cgggaggtaat--ccccatg
P53563_BCL2L1-02       --ggccacagcagcagtttggatgcg----cgggaggtaat--ccccatg
P53563_BCL2L1-03       --ggccacagcagcagtttggatgcg----cgggaggtaat--ccccatg
                                                                         

Q99M66_BCL2L10-01      -----------------------------agatggcgg--------atga
Q9Z1P3_MCL1-01         ccctccacgccgccgccgcctgaggaggaagacgacgagctgtaccacca
O88996_BCL2L2-01       -----------------------------agctggaga------------
Q7TS60_BCL2L2-01       -----------------------------agctggaga------------
Q7TSN8_BCL2-01         ccacctgtggtccatctgaccctccgccgggctgggga------------
F1LNV0_BCL2-01         ccacctgtggtccacctgaccctccgccgggctgggga------------
P49950_BCL2-01         ccacctgtggtccacctgaccctccgccgggctgggga------------
G3V977_BCL2A1-01       ---------------gta---caaaaggaagttgaaaa------------
Q925A9_BCL2A1-01       ---------------gta---caaaaggaagttgaaaa------------
P53563_BCL2L1-01       gcagcagtgaagcaagcg---ctgagagaggctggcga------------
P53563_BCL2L1-02       gcagcagtgaagcaagcg---ctgagagaggctggcga------------
P53563_BCL2L1-03       gcagcagtgaagcaagcg---ctgagagaggctggcga------------
                                                     *  *                

Q99M66_BCL2L10-01      gttgct---------------------------------------ctcca
Q9Z1P3_MCL1-01         gtcgctggagatcatctcccgctacctgcgggagcaggcgacgggctcca
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      atga--ccaagagttcaactggggccg-------------------cctg
Q9Z1P3_MCL1-01         aggacgcgaagcctctgggcgaggccggcgcagcgggccggagggcgctg
O88996_BCL2L2-01       ---------cgagtttgagacccgctt-------------------c-cg
Q7TS60_BCL2L2-01       ---------cgagtttgagacccgctt-------------------c-cg
Q7TSN8_BCL2-01         ---------tgacttctctcgtcgcta-------------------c-cg
F1LNV0_BCL2-01         ---------tgacttctctcgtcgcta-------------------c-cg
P49950_BCL2-01         ---------tgacttctctcgtcgcta-------------------c-cg
G3V977_BCL2A1-01       ----------gaatctgaa--gccata-------------------cttg
Q925A9_BCL2A1-01       ----------gaatctgaa--gccata-------------------cttg
P53563_BCL2L1-01       ---------tgagtttgaactgcggta-------------------c-cg
P53563_BCL2L1-02       ---------tgagtttgaactgcggta-------------------c-cg
P53563_BCL2L1-03       ---------tgagtttgaactgcggta-------------------c-cg
                                 *  *                                   *

Q99M66_BCL2L10-01      gtgatgctcc------------------------------------tg--
Q9Z1P3_MCL1-01         gagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacg--
O88996_BCL2L2-01       gcgcaccttctctgacctggccgctcagctacacgtgaccccagg-----
Q7TS60_BCL2L2-01       gcgcaccttctctgacctggccgctcagctacacgtgaccccagg-----
Q7TSN8_BCL2-01         tcgtgacttcgcagagatgtccagtcagctgcacctgacgccctt-----
F1LNV0_BCL2-01         tcgcgactttgcagagatgtccagtcagctgcacctgacgccctt-----
P49950_BCL2-01         tcgcgactttgcagagatgtccagtcagctgcacctgacgccctt-----
G3V977_BCL2A1-01       gatgactttca--------------------cgtggaatccatagatact
Q925A9_BCL2A1-01       gatgactttca--------------------cgtggaatccatagatact
P53563_BCL2L1-01       gagagcattcagtgatctaacatcccagcttcatataaccccagg-----
P53563_BCL2L1-02       gagagcattcagtgatctaacatcccagcttcatataaccccagg-----
P53563_BCL2L1-03       gagagcattcagtgatctaacatcccagcttcatataaccccagg-----
                              *                                          

Q99M66_BCL2L10-01      gccttcgtggggacgctaatgaaccaagac----------aggac--tgt
Q9Z1P3_MCL1-01         gccttccagggcatgcttcggaaactggacattaaaaacgaggacgatgt
O88996_BCL2L2-01       ctcagcccagcaacgcttcacc----------------------------
Q7TS60_BCL2L2-01       ctcagcccagcaacgcttcacc----------------------------
Q7TSN8_BCL2-01         caccgcgaggggacgctttgcc----------------------------
F1LNV0_BCL2-01         caccgcgaggggacgctttgcc----------------------------
P49950_BCL2-01         caccgcgaggggacgctttgcc----------------------------
G3V977_BCL2A1-01       gccagaataata----ttcaac----------------------------
Q925A9_BCL2A1-01       gccagaataata----ttcaac----------------------------
P53563_BCL2L1-01       gacagcatatcagagctttgaa----------------------------
P53563_BCL2L1-02       gacagcatatcagagctttgaa----------------------------
P53563_BCL2L1-03       gacagcatatcagagctttgaa----------------------------
                         *             *                                 

Q99M66_BCL2L10-01      taag---------cggaggaggga--------tcaaagaaaccgtctcct
Q9Z1P3_MCL1-01         taaatctttttctcgagtgatgacccatgttttcaaagatggcgtaacaa
O88996_BCL2L2-01       -------------caggtttccgacgaacttttccaagggggcccc---a
Q7TS60_BCL2L2-01       -------------caggtttccgacgaacttttccaagggggcccc---a
Q7TSN8_BCL2-01         -------------acggtggtggaggaactcttcagggatggggtg---a
F1LNV0_BCL2-01         -------------acggtggtggaggaactcttcagggatggggtg---a
P49950_BCL2-01         -------------acggtggtggaggaactcttcagggatggggtg---a
G3V977_BCL2A1-01       -------------caagtgatggaaaaagaatttgaagatggcatcatta
Q925A9_BCL2A1-01       -------------caagtgatggaaaaagaatttgaagatggcatcatta
P53563_BCL2L1-01       -------------caggtagtgaatgaactctttcgggatggggta---a
P53563_BCL2L1-02       -------------caggtagtgaatgaactctttcgggatggggta---a
P53563_BCL2L1-03       -------------caggtagtgaatgaactctttcgggatggggta---a
                                                       *    *            

Q99M66_BCL2L10-01      actggagcgagactgcta--------tctcatagtgagcttgctgt---a
Q9Z1P3_MCL1-01         actggggcaggattgtgactcttatttcttttggtgcctttgtggccaaa
O88996_BCL2L2-01       actggggccgtcttgtggcattctttgtctttggggc------tgccctg
Q7TS60_BCL2L2-01       actggggccgtcttgtggcattctttgtctttggggc------tgccctg
Q7TSN8_BCL2-01         actgggggaggattgtggccttctttgagttcggtgg------ggtcatg
F1LNV0_BCL2-01         actgggggaggattgtggccttctttgagttcggtgg------ggtcatg
P49950_BCL2-01         actgggggaggattgtggccttctttgagttcggtgg------ggtcatg
G3V977_BCL2A1-01       actggggaaggattgtgactatatttgcctttg--gg------ggtgttc
Q925A9_BCL2A1-01       actggggaaggattgtgactatatttgcctttg--gg------ggtgttc
P53563_BCL2L1-01       actggggtcgcattgtggccttcttctcctttggcgg------ggcactg
P53563_BCL2L1-02       actggggtcgcattgtggccttcttctcctttggcgg------ggcactg
P53563_BCL2L1-03       actggggtcgcattgtggccttcttctcctttggcgg------ggcactg
                       ***** *      **                    *        *     

Q99M66_BCL2L10-01      ca----------atcgactcac------------agg-------------
Q9Z1P3_MCL1-01         cacttaaagagcataaaccaag------------aaa-------------
O88996_BCL2L2-01       tgtgctgagagtgtcaacaaag------------aaatggagccattggt
Q7TS60_BCL2L2-01       tgtgctgagagtgtcaacaaag------------aaatggagccattggt
Q7TSN8_BCL2-01         tgtgtggagagcgtcaacaggg------------agatgtcacccctggt
F1LNV0_BCL2-01         tgtgtggagagcgtcaacaggg------------agatgtcacccctggt
P49950_BCL2-01         tgtgtggggagcgtcaacaggg------------agatgtcacccctggt
G3V977_BCL2A1-01       tcctgaaaaagcttccacaagagcagattgccctggatgtggatacttac
Q925A9_BCL2A1-01       tcctgaaaaagcttccacaagagcagattggcctggatgtggatacttac
P53563_BCL2L1-01       tgcgtggaaagcgtagacaagg------------agatgcaggtattggt
P53563_BCL2L1-02       tgcgtggaaagcgtagacaagg------------agatgcaggtattggt
P53563_BCL2L1-03       tgcgtggaaagcgtagacaagg------------agatgcaggtattggt
                                    *  **                                

Q99M66_BCL2L10-01      ---------acggcatcgctc-----------------------------
Q9Z1P3_MCL1-01         ---------gctgcatcgaacctttagcagaaagtatcacagacgttctt
O88996_BCL2L2-01       gggacaagtgcaggat-------tggatggtgacctacctggagacacgc
Q7TS60_BCL2L2-01       gggacaagtgcaggat-------tggatggtgacctacctggagacacgc
Q7TSN8_BCL2-01         gg-------acaacatcgccctgtggatgactgagtacctgaaccggcat
F1LNV0_BCL2-01         gg-------acaacatcgctctgtggatgactgagtacctgaaccggcat
P49950_BCL2-01         gg-------acaacatcgctctgtggatgactgagtacctgaaccggcat
G3V977_BCL2A1-01       aa-------g-caagtttccagttttgtggcggaattcataatgaataac
Q925A9_BCL2A1-01       aa-------g-caagtttccagttttgtggcggaattcataatgaataac
P53563_BCL2L1-01       ga-------gtcggattgcaagttggatggccacctacctgaatgaccac
P53563_BCL2L1-02       ga-------gtcggattgcaagttggatggccacctacctgaatgaccac
P53563_BCL2L1-03       ga-------gtcggattgcaagttggatggccacctacctgaatgaccac
                                      *                                  

Q99M66_BCL2L10-01      -----------------ctggctggaggctcacggtggctgg--------
Q9Z1P3_MCL1-01         gtaaggacgaagcgggactggcttgtgaaacaaagaggctgg--------
O88996_BCL2L2-01       ttggctga---------ctggatccacagcagtgggggctgg--------
Q7TS60_BCL2L2-01       ttggctga---------ctggatccacagcagtgggggctgg--------
Q7TSN8_BCL2-01         ctgcacac---------ctggatccaggataacggaggctgg--------
F1LNV0_BCL2-01         ctgcacac---------ctggatccaggataacggaggctgg--------
P49950_BCL2-01         ctgcacac---------ctggatccaggataacggaggctgg--------
G3V977_BCL2A1-01       acaggaga---------atggatacagcagaatggaggctgg--------
Q925A9_BCL2A1-01       acaggaga---------atggatacagcagaatggaggctgg--------
P53563_BCL2L1-01       ctagagcc---------ttggatccaggagaacggcggctgg--------
P53563_BCL2L1-02       ctagagcc---------ttggatccaggagaacggcggctgggtaagaac
P53563_BCL2L1-03       ctagagcc---------ttggatccaggagaacggcggctgggtaagaac
                                         *** *           * ******        

Q99M66_BCL2L10-01      ------------------gatggcttttgccaattcttc------aagaa
Q9Z1P3_MCL1-01         ------------------gatgggtttgtggagttcttccacgtacagga
O88996_BCL2L2-01       ------------------gcggagttcacagctctatac-----------
Q7TS60_BCL2L2-01       ------------------gcggagttcacagctctatac-----------
Q7TSN8_BCL2-01         ------------------gatgcctttgtggaactatat-----------
F1LNV0_BCL2-01         ------------------gatgcctttgtggaactatat-----------
P49950_BCL2-01         ------------------gatgcctttgtggaactatat-----------
G3V977_BCL2A1-01       ---------------------------gaagat-----------------
Q925A9_BCL2A1-01       ---------------------------gaagat-----------------
P53563_BCL2L1-01       ------------------gacacttttgtggat-----------------
P53563_BCL2L1-02       cacgccccttgtgtgtccgccccttgtgtgtct-----------------
P53563_BCL2L1-03       cacgccccttgtgtgtccgccccttgtgtgtct-----------------
                                                                         

Q99M66_BCL2L10-01      ccccttaccacccggcttctggagaagatt------gctgatccgggcta
Q9Z1P3_MCL1-01         cc---tagaaggcggcatc---agaaatgt------gctg---ctggctt
O88996_BCL2L2-01       -----ggggacggggccctggaggaggcac--ggcgtctgcgggagggga
Q7TS60_BCL2L2-01       -----ggggacggggccctggaggaggcac--ggcgtctgcgggagggga
Q7TSN8_BCL2-01         -------------ggccccagc----atgc--gacctctgtttgatttct
F1LNV0_BCL2-01         -------------ggccccagc----atgc--gacctctgtttgatttct
P49950_BCL2-01         -------------ggccccagc----atgc--gacctctgtttgatttct
G3V977_BCL2A1-01       -------------ggcttcacaaagaagtttgaac--ctaaatctggctg
Q925A9_BCL2A1-01       -------------ggcttcacaaagaagtttgaac--ctaaatctggctg
P53563_BCL2L1-01       -------------ctctacgggaacaatgc--agcagcc-----------
P53563_BCL2L1-02       -------------ctcctctgtggagatccctaactgccctttttggtct
P53563_BCL2L1-03       -------------ctcctctgtggagatccctaactgccctttttggtct
                                      *                     *            

Q99M66_BCL2L10-01      ttctgtcctgtttcttt-gcaacggcc-atcttt----------------
Q9Z1P3_MCL1-01         ttgcgg-gtgttgctggagtaggggctggtctgg----------------
O88996_BCL2L2-01       actggg--catcagtgaggacagtgctgacggggg---------------
Q7TS60_BCL2L2-01       actggg--catcagtgaggacagtgctgacggggg---------------
Q7TSN8_BCL2-01         cctggc--tgtctctgaagaccctgctcagcctgg---------------
F1LNV0_BCL2-01         cctggc--tgtctctgaagacgctgctcagcctgg---------------
P49950_BCL2-01         cctggc--tgtctctgaagacgctgctcagcctgg---------------
G3V977_BCL2A1-01       gctgacttttctgcagatgacagggaagatctgggaaatgctc-------
Q925A9_BCL2A1-01       gctgacttttctgcagatgacagggaagatctgggaaatgctc-------
P53563_BCL2L1-01       ----------------gagagccggaaaggccaggag-------------
P53563_BCL2L1-02       cctggcatggttgttgaagatatcgattattcaggagacattcctggctt
P53563_BCL2L1-03       cctggcatggttgttgaagatatcgattattcaggagacattcctggctt
                                         *     *                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       ---------------------------------------ctgtggcactg
Q7TS60_BCL2L2-01       ---------------------------------------ctgtggcactg
Q7TSN8_BCL2-01         ---------------------------------------ccctgg---tc
F1LNV0_BCL2-01         ---------------------------------------ccctgg---tg
P49950_BCL2-01         ---------------------------------------ccctgg---tg
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       cgtttcaaccgctg-----------------------------gttcctg
P53563_BCL2L1-02       cactttaataccaggggttaactttgggaatattgatgaccctgttttta
P53563_BCL2L1-03       cactttaataccaggggttaactttgggaatattgatgaccctgttttta
                                                                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
O88996_BCL2L2-01       ggggccctg-----gtaactgtaggggccttt------------------
Q7TS60_BCL2L2-01       ggggccctg-----gtaactgtaggggccttt------------------
Q7TSN8_BCL2-01         ggggcctgc-----atcactctgggtgcatac------------------
F1LNV0_BCL2-01         ggggcctgc-----atcactctgggtgcatac------------------
P49950_BCL2-01         ggggcctgc-----atcactctgggtgcatac------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       acgggcatg--------actgtggctg-----gtg--------------t
P53563_BCL2L1-02       aggaacctgtatttttcattctggctacccttgtggccccgcagtttcat
P53563_BCL2L1-03       aggaacctgtatttttcattctggctacccttgtggccccgcagtttcat
                                                                         

Q99M66_BCL2L10-01      -------------tatatctggaaatgtttataa----------------
Q9Z1P3_MCL1-01         -------------catatctaataagg----tag----------------
O88996_BCL2L2-01       -------------tttgctagcaagtga----------------------
Q7TS60_BCL2L2-01       -------------tttgctagcaagtga----------------------
Q7TSN8_BCL2-01         -------------ctgggccacaagtga----------------------
F1LNV0_BCL2-01         -------------ctgggccacaagtga----------------------
P49950_BCL2-01         -------------ctgggccacaagtga----------------------
G3V977_BCL2A1-01       -------------tttctcctcaagcaacacta-----------------
Q925A9_BCL2A1-01       -------------tttctcctcaagcaacacta-----------------
P53563_BCL2L1-01       agttctgctgggctcactcttcagtcggaagtga----------------
P53563_BCL2L1-02       agttttgttccaatttctcggcaaagaaaaacagcctgtgtgtttacttg
P53563_BCL2L1-03       agttttgttccaatttctcggcaaagaaaaacagcctgtgtgtttacttg
                                                                         

Q99M66_BCL2L10-01      -------------
Q9Z1P3_MCL1-01         -------------
O88996_BCL2L2-01       -------------
Q7TS60_BCL2L2-01       -------------
Q7TSN8_BCL2-01         -------------
F1LNV0_BCL2-01         -------------
P49950_BCL2-01         -------------
G3V977_BCL2A1-01       ---------ctga
Q925A9_BCL2A1-01       ---------ctga
P53563_BCL2L1-01       -------------
P53563_BCL2L1-02       gcttaaaacctag
P53563_BCL2L1-03       gcttaaaacctag
                                    

© 1998-2020Legal notice