Dataset for CDS Unclassified of Organism Chrysemys picta bellii

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3HFS0_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Chrysemys picta bellii (length=570 residues).
atggagacgcaccaggccggggggctgccatttgccccagctcgcccatcccccaccggtgccgagagcatttcctgcat
caagcaaatcggggcgtccctgctccgggggttcgtccggtccctactccagcagcagggccctgggtcccccccggccc
ggtcggtcaccatggaggagctggggggccaggacacccctgatgggccccgggtcgcgtccctgcgtgagactctgcac
cggatatgggagagcatgagccagaaccccgagatcgacagcctggtgcagtgcatggcggggcagccccccctgccggc
actggccgcggtctcggaggaggtgttttgtgacggcatcaactggggcagagtcgtcgtcttcttctacttcacctaca
gggtcatcgcccaggctctgggcgggtctgactgtctccggtccctggtggactgggccctaaacttcctgtgggagcga
gtcgccccctggatccagcgccaggggggatgggtgagtgcagagacccctccccacatcctccctgggacccctccccc
accccagaga
>gnl|bcl2dbcds|A0A8C3IR52_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chrysemys picta bellii (length=459 residues).
atgtctcaatcaagaagaatccccaggcattttgttctctctcacgaccagaatggagtagcagtaccaaacgaggaaag
ccagaatagactattaacagttccagacaacacagagcaaatggcgtttaatatcagctctgccacccaagttggccatc
agctggcagtcattggggatgaatttaacaacacatacactaggaagttagaggacatgctgtttcatcttgcacagggg
atggctgtgaatgttttaaaaatactccatatgcatgtttggaaaagtattctaaaaagtttcagaagtcttttgaacaa
tggttggactaagagagttgttgcctatggaagctggatttctaggcttcctcttaagtccatgtgccagaggttgatgc
cggcagccctgtttgtcatcttattttggtggactgtcagttatggattgcagaactaa
© 1998-2023Legal notice