Dataset for CDS BCL-2-like of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9YDG7_BCL2A1-      ------atggc-------------ggc------------------agcgg
A0A8B9YDG7_BCL2A1-      ------atgactgacactgagtttggc------------------tacgt
A0A8B9YDG7_BCL2A1-      ------atgactgacactgagtttggc------------------tacgt
A0A8B9YDG7_BCL2A1-      ------atgactgacactgagtttggc------------------tacgt
A0A8B9WB42_BCL2L1-      ------atg------------------tctcag------------agcaa
A0A8B9X9C2_BCL2L1-      aaatttatc------------------ttacagggaaaggggtatagcaa
A0A8B9XQH5_BCL2L1-      ------atg------------------tctcag------------agtaa
A0A8B9Y853_BCL2L10      ------atg-cgagaaggggcggggcgtcg--------------------
A0A8B9Y853_BCL2L10      ------atg-cgagaaggggcggggcgtcg--------------------
A0A4P8GLJ2_BCL2-01      ------atggcg--------------cacgcgg------------gggga
A0A8B9WT05_BCL2L2-      ------atggcgaccccagcctcggcccc---a------------gacac
A0A8B9W7D1_MCL1-03      ------atg-----------ttcggcctcaaga------------gaaac
A0A8B9W7D1_MCL1-04      ------atg-----------ttcggcctcaaga------------gaaac
A0A8B9W7D1_MCL1-01      ------atg-----------ttcggcctcaaga------------gaaac
A0A8B9W7D1_MCL1-02      ------atg-----------ttcggcctcaaga------------gaaac
                              **                                          

A0A8B9YDG7_BCL2A1-      --------tggccgtgagc-------------------------------
A0A8B9YDG7_BCL2A1-      tcacgggctggctgaggact---------atctgaaatatgtgttgca-g
A0A8B9YDG7_BCL2A1-      tcacgggctggctgaggact---------atctgaaatatgtgttgca-g
A0A8B9YDG7_BCL2A1-      tcacgggctggctgaggact---------atctgaaatatgtgttgca-g
A0A8B9WB42_BCL2L1-      tcgggaactagtggttgact----------------ttctctcttacaag
A0A8B9X9C2_BCL2L1-      ccgacggctggtggttgact----------------ttctctcttacaag
A0A8B9XQH5_BCL2L1-      ccgggagctggtggttgact----------------ttctctcttacaag
A0A8B9Y853_BCL2L10      gcaggcccagaaaacaggccggg--------gtcggacccccggtagagg
A0A8B9Y853_BCL2L10      gcaggcccagaaaacaggccggg--------gtcggacccccggtagagg
A0A4P8GLJ2_BCL2-01      acaggctacgataaccga--gagatcgtgatgaagtacatccactataag
A0A8B9WT05_BCL2L2-      acgggctctagtggcagact---------ttgtgggcta-------taag
A0A8B9W7D1_MCL1-03      gcag----taat--cggactaaacctctattgtgggggagccggattagg
A0A8B9W7D1_MCL1-04      gcag----taat--cggactaaacctctattgtgggggagccggattagg
A0A8B9W7D1_MCL1-01      gcag----taat--cggactaaacctctattgtgggggagccggattagg
A0A8B9W7D1_MCL1-02      gcag----taat--cggactaaacctctattgtgggggagccggattagg
                                                                          

A0A8B9YDG7_BCL2A1-      ------------ggcgcca-------------------------------
A0A8B9YDG7_BCL2A1-      atacagcaacctggatcca-------------------------------
A0A8B9YDG7_BCL2A1-      atacagcaacctggatcca-------------------------------
A0A8B9YDG7_BCL2A1-      atacagcaacctggatcca-------------------------------
A0A8B9WB42_BCL2L1-      ctttcccagaaaggatacagctggagtc------agtttagtg-------
A0A8B9X9C2_BCL2L1-      ctttcccagaaaggatacagctggagtc------gatttaatgatgtgga
A0A8B9XQH5_BCL2L1-      ctttcccagaaaggatacagctggagtc------agtttagtgatgtgga
A0A8B9Y853_BCL2L10      cggagccatggtggacccgtttagggag----------------------
A0A8B9Y853_BCL2L10      cggagccatggtggacccgtttagggag----------------------
A0A4P8GLJ2_BCL2-01      ctgtcgcagcggggctacgagtgggatg---------ccggagacgcggg
A0A8B9WT05_BCL2L2-      ctgaggcagaaggggtatgtttgtggag---------ctggccccgggga
A0A8B9W7D1_MCL1-03      acagggcagcggcgcctcctctccgggggggcggcttttggctgcgggga
A0A8B9W7D1_MCL1-04      acagggcagcggcgcctcctctccgggggggcggctttt-----------
A0A8B9W7D1_MCL1-01      acagggcagcggcgcctcctctccgggggggcggcttttggctgcgggga
A0A8B9W7D1_MCL1-02      acagggcagcggcgcctcctctccgggggggcggcttttggctgcgggga
                                     *                                    

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      ----------------------------------tcagatatg-------
A0A8B9X9C2_BCL2L1-      agagaacagaactgaggcctcggaagggacaaaatcagatatg-------
A0A8B9XQH5_BCL2L1-      agagaacagaactgaggccccagaagggacagaatcagatatg-------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      cg------------------------------------------------
A0A8B9WT05_BCL2L2-      ggg-----------------------------------------------
A0A8B9W7D1_MCL1-03      aggaggccacggcgcggcgagaggtagggggaggggaagccggcacggtg
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      aggaggccacggcgcggcgagaggtagggggaggggaagccggcacggtg
A0A8B9W7D1_MCL1-02      aggaggccacggcgcggcgagaggtagggggaggggaagccggcacggtg
                                                                          

A0A8B9YDG7_BCL2A1-      -------------------------------agcgg--------------
A0A8B9YDG7_BCL2A1-      -------------------------------agcca--------------
A0A8B9YDG7_BCL2A1-      -------------------------------agcca--------------
A0A8B9YDG7_BCL2A1-      -------------------------------agcca--------------
A0A8B9WB42_BCL2L1-      --------------------gaaacccccagtg-gatcagt---------
A0A8B9X9C2_BCL2L1-      --------------------gaaa-ccccaatgccatcaat---------
A0A8B9XQH5_BCL2L1-      --------------------gaaacccccagtgccatcaat---------
A0A8B9Y853_BCL2L10      -------------------cgcaccgccc--ggctgct------------
A0A8B9Y853_BCL2L10      -------------------cgcaccgccc--ggctgct------------
A0A4P8GLJ2_BCL2-01      ------------------ccgcgccccccggggccgctcccgcgccg---
A0A8B9WT05_BCL2L2-      --------------------------ccc--agcagct------------
A0A8B9W7D1_MCL1-03      attggcggaagcgccggcccgagcccccc--ggccactcttgcgcccgac
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      attggcggaagcgccggcccgagcccccc--ggccactcttgcgcccgac
A0A8B9W7D1_MCL1-02      attggcggaagcgccggcccgagcccccc--ggccactcttgcgcccgac
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      gcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgt
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgt
A0A8B9W7D1_MCL1-02      gcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgt
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      caccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgt
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      caccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgt
A0A8B9W7D1_MCL1-02      caccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgt
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      cgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgccc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      cgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgccc
A0A8B9W7D1_MCL1-02      cgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgccc
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      gaagaggagctggacgggtgcgagccagaccctctcgggaagcggcctgc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gaagaggagctggacgggtgcgagccagaccctctcgggaagcggcctgc
A0A8B9W7D1_MCL1-02      gaagaggagctggacgggtgcgagccagaccctctcgggaagcggcctgc
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      cgtccggcctttacctttgttggtcggagaagccagtaacaacagtccag
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      cgtccggcctttacctttgttggtcggagaagccagtaacaacagtccag
A0A8B9W7D1_MCL1-02      cgtccggcctttacctttgttggtcggagaagccagtaacaacagtccag
                                                                          

A0A8B9YDG7_BCL2A1-      --------agc---------------------------------------
A0A8B9YDG7_BCL2A1-      --------agcaaaatatcc------------------------------
A0A8B9YDG7_BCL2A1-      --------agcaaaatatcc------------------------------
A0A8B9YDG7_BCL2A1-      --------agcaaaatatcc------------------------------
A0A8B9WB42_BCL2L1-      --------ggcaacccatcc------------------------------
A0A8B9X9C2_BCL2L1-      --------gacaacccatct------------------------------
A0A8B9XQH5_BCL2L1-      --------ggcaacgcatcc------------------------------
A0A8B9Y853_BCL2L10      --------gatggactacct------------------------------
A0A8B9Y853_BCL2L10      --------gatggactacct------------------------------
A0A4P8GLJ2_BCL2-01      --------ggcatcctgtcctcccagccgggccgcacacc----------
A0A8B9WT05_BCL2L2-      --------gacccgctacac------------------------------
A0A8B9W7D1_MCL1-03      gctcggacggctcgctgccctcgacgccgcccccagcagaggaggaggag
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gctcggacggctcgctgccctcgacgccgcccccagcagaggaggaggag
A0A8B9W7D1_MCL1-02      gctcggacggctcgctgccctcgacgccgcccccagcagaggaggaggag
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --agggtgttacaaga----------------------------------
A0A8B9YDG7_BCL2A1-      --agggtgttacaaga----------------------------------
A0A8B9YDG7_BCL2A1-      --agggtgttacaaga----------------------------------
A0A8B9WB42_BCL2L1-      --tggcacctggcagatagccccacagtgaatgga---------------
A0A8B9X9C2_BCL2L1-      --t-----------------------------------------------
A0A8B9XQH5_BCL2L1-      --tggcacctggcggatagccctgctgtgaatgga---------------
A0A8B9Y853_BCL2L10      --ggagttctgcg------cccgggagcccggcac---------------
A0A8B9Y853_BCL2L10      --ggagttctgcg------cccgggagcccggcac---------------
A0A4P8GLJ2_BCL2-01      --cgcgccctccaggacctccccgccgccgccccc---------------
A0A8B9WT05_BCL2L2-      --caagccatgcgggcag---ctggagatgagttc---------------
A0A8B9W7D1_MCL1-03      gacgagttatatcggcagtccctggagataatctctcagtacctccggga
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gacgagttatatcggcagtccctggagataatctctcagtacctccggga
A0A8B9W7D1_MCL1-02      gacgagttatatcggcagtccctggagataatctctcagtacctccggga
                                                                          

A0A8B9YDG7_BCL2A1-      ------------------------------------ctg--cgggccg--
A0A8B9YDG7_BCL2A1-      -------------------------tgtggcttcctctgtccaggacg--
A0A8B9YDG7_BCL2A1-      -------------------------tgtggcttcctctgtccaggacg--
A0A8B9YDG7_BCL2A1-      -------------------------tgtggcttcctctgtccaggacg--
A0A8B9WB42_BCL2L1-      ----gccactggccacag-------cagaagcttggatgcccagaaaacg
A0A8B9X9C2_BCL2L1-      ----gccactggccacag-------cagaagcttggacgcctggaaagtg
A0A8B9XQH5_BCL2L1-      ----gccactggccacag-------cagaagctcggatgcccgggaagtg
A0A8B9Y853_BCL2L10      -------tccagctcctgcgccgt-ccacgcctgaggctgccgtgctg--
A0A8B9Y853_BCL2L10      -------tccagctcctgcgccgt-ccacgcctgaggctgccgtgctg--
A0A4P8GLJ2_BCL2-01      ---ggccgccgccgccgggcctgcgcccagcccggtgccgcctg------
A0A8B9WT05_BCL2L2-      ----gagacccgcttc-------cggcgcaccttctccgatctggcag--
A0A8B9W7D1_MCL1-03      gcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggac--
A0A8B9W7D1_MCL1-04      ---ggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggac--
A0A8B9W7D1_MCL1-01      gcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggac--
A0A8B9W7D1_MCL1-02      gcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggac--
                                                                          

A0A8B9YDG7_BCL2A1-      -------------ag------------ctgaagca---------------
A0A8B9YDG7_BCL2A1-      -------------aagtggaaaggactctgaagcagtgcttggataagtt
A0A8B9YDG7_BCL2A1-      -------------aagtggaaaggactctgaagcagtgcttggataagtt
A0A8B9YDG7_BCL2A1-      -------------aagtggaaaggactctgaagcagtgcttggataagtt
A0A8B9WB42_BCL2L1-      atccccatgacaacagtaaagcaagccctgagggaggcaagcaatgagtt
A0A8B9X9C2_BCL2L1-      atccccgtgacaacagaaaagcaagccctgagggaggcaggcaatga---
A0A8B9XQH5_BCL2L1-      atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtt
A0A8B9Y853_BCL2L10      --cgccacgt---ggccgcacgtatccaggaagcaaatcga------aac
A0A8B9Y853_BCL2L10      --cgccacgt---ggccgcacgtatccaggaagcaaatcga------aac
A0A4P8GLJ2_BCL2-01      -------------tggtgcacctgaccctgcgccaggccggcgatgactt
A0A8B9WT05_BCL2L2-      --ctc--------agctgcatgtgaccccgggc----tcgg---------
A0A8B9W7D1_MCL1-03      --cacaagccggaaggcgttggagaccctgcgccgagtcggggatggggt
A0A8B9W7D1_MCL1-04      --cacaagccggaaggcgttggagaccctgcgccgagtcggggatggggt
A0A8B9W7D1_MCL1-01      --cacaagccggaaggcgttggagaccctgcgccgagtcggggatggggt
A0A8B9W7D1_MCL1-02      --cacaagccggaaggcgttggagaccctgcgccgagtcggggatggggt
                                                     *                    

A0A8B9YDG7_BCL2A1-      -------------------gcgtctgcgggcg------------------
A0A8B9YDG7_BCL2A1-      tgat------------gtggtgtccgtagaca------------------
A0A8B9YDG7_BCL2A1-      tgat------------gtggtgtccgtagaca------------------
A0A8B9YDG7_BCL2A1-      tgat------------gtggtgtccgtagaca------------------
A0A8B9WB42_BCL2L1-      taaactgaggtaccaacagacattcagcgacctgatgtcccagctccgca
A0A8B9X9C2_BCL2L1-      ---------------------------cgaccagacgtcccagctccaca
A0A8B9XQH5_BCL2L1-      tgaactgaggtaccgacgggcattcagcgacctgacgtcccagctccaca
A0A8B9Y853_BCL2L10      gtcttgcccctataccgccgctgccgcaggca------------------
A0A8B9Y853_BCL2L10      gtcttgcccctataccgccgctgccgcaggca------------------
A0A4P8GLJ2_BCL2-01      ctctcggcgctaccgccgcgacttcgccgagatgtccagtcaactgcacc
A0A8B9WT05_BCL2L2-      ------------------------cccagcaacgcttc------------
A0A8B9W7D1_MCL1-03      gcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggaca
A0A8B9W7D1_MCL1-04      gcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggaca
A0A8B9W7D1_MCL1-01      gcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggaca
A0A8B9W7D1_MCL1-02      gcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggaca
                                                    *                     

A0A8B9YDG7_BCL2A1-      ------------ctg-------------------agcgctg---------
A0A8B9YDG7_BCL2A1-      ------------ctgccagaacaatattcaaccaagtgatggaaaaggaa
A0A8B9YDG7_BCL2A1-      ------------ctgccagaacaatattcaaccaagtgatggaaaaggaa
A0A8B9YDG7_BCL2A1-      ------------ctgccagaacaatattcaaccaagtgatggaaaaggaa
A0A8B9WB42_BCL2L1-      tcaccccagggacagcatgtcagagctttgaacaggtaataaatgaactc
A0A8B9X9C2_BCL2L1-      tcaccccagggacagcatatcagagctttgaacagatgatgtatgaactc
A0A8B9XQH5_BCL2L1-      tcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactc
A0A8B9Y853_BCL2L10      -------------ccgcgtcgagctggtggccaggatggcgcagaggcta
A0A8B9Y853_BCL2L10      -------------ccgcgtcgagctggtggccaggatggcgcagaggcta
A0A4P8GLJ2_BCL2-01      tgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctc
A0A8B9WT05_BCL2L2-      ----------------------acccaggtctctgatga------actct
A0A8B9W7D1_MCL1-03      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgtt
A0A8B9W7D1_MCL1-04      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgtt
A0A8B9W7D1_MCL1-01      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgtt
A0A8B9W7D1_MCL1-02      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgtt
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      tttgaagatggcattgt---taactggggcaggattgtaaccatattcgc
A0A8B9YDG7_BCL2A1-      tttgaagatggcattgt---taactggggcaggattgtaaccatattcgc
A0A8B9YDG7_BCL2A1-      tttgaagatggcattgt---taactggggcaggattgtaaccatattcgc
A0A8B9WB42_BCL2L1-      ttccgggacag---ggt---gaagtggggtcacgttgtggcctttttctc
A0A8B9X9C2_BCL2L1-      ctccaggacgg---ggt---gaactggggtcgcattgtggcctttttttc
A0A8B9XQH5_BCL2L1-      ttccgggacgg---ggt---gaactggggtcgcattgtggcctttttctc
A0A8B9Y853_BCL2L10      ctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgac
A0A8B9Y853_BCL2L10      ctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgac
A0A4P8GLJ2_BCL2-01      ttcagggacgg---ggt---gaactgggggcgcatcgtggccttctttga
A0A8B9WT05_BCL2L2-      tccaa----gg---gggccccaactggggccgccttgtggccttctttgt
A0A8B9W7D1_MCL1-03      ttcagtgacgg---agtaacaaactggggcaggattgtgactcttatttc
A0A8B9W7D1_MCL1-04      ttcagtgacgg---agtaacaaactggggcaggattgtgactcttatttc
A0A8B9W7D1_MCL1-01      ttcagtgacgg---agtaacaaactggggcaggattgtgactcttatttc
A0A8B9W7D1_MCL1-02      ttcagtgacgg---agtaacaaactggggcaggattgtgactcttatttc
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------aggagcggctg---------cgccag----
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttaccaagaaacttctg---------ggcaagtgta
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttaccaagaaacttctg---------ggcaagtgta
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttaccaagaaacttctg---------ggcaagtgta
A0A8B9WB42_BCL2L1-      cttcagtgggacactgtgc-----------at--------gaaaagcata
A0A8B9X9C2_BCL2L1-      cttcagtggggcactatgc-----------at--------ggaaagcata
A0A8B9XQH5_BCL2L1-      cttcggtggggcactgtgc-----------gt--------ggaaagcgta
A0A8B9Y853_BCL2L10      ctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcagg
A0A8B9Y853_BCL2L10      ctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcagg
A0A4P8GLJ2_BCL2-01      gttcggaggggtcatgtgt-----------gt--------ggagagcgtc
A0A8B9WT05_BCL2L2-      ctttggagccgcgttgtgt-----------gc--------tgagagtgtc
A0A8B9W7D1_MCL1-03      ttttggtgc--ctttgtgg-----------ccaaacacttgaagagtata
A0A8B9W7D1_MCL1-04      ttttggtgc--ctttgtgg-----------ccaaacacttgaagagtata
A0A8B9W7D1_MCL1-01      ttttggtgc--ctttgtgg-----------ccaaacacttgaagagtata
A0A8B9W7D1_MCL1-02      ttttggtgc--ctttgtgg-----------ccaaacacttgaagagtata
                                                                     *    

A0A8B9YDG7_BCL2A1-      --------------------------------------tcccacctct-t
A0A8B9YDG7_BCL2A1-      ttgcctcag------acatggacatgtgcaaggacatttcttactttg-t
A0A8B9YDG7_BCL2A1-      ttgcctcag------acatggacatgtgcaaggacatttcttactttg-t
A0A8B9YDG7_BCL2A1-      ttgcctcag------acatggacatgtgcaaggacatttcttactttg-t
A0A8B9WB42_BCL2L1-      gacaaggag------atacacgtattggtgagtcaggtcacaacttcaat
A0A8B9X9C2_BCL2L1-      gacaaggag------acacaagtattggtgagtcaaagcacaacttggat
A0A8B9XQH5_BCL2L1-      gacaaggag------atgcaggtattggtgagtcggatcgcaacttggat
A0A8B9Y853_BCL2L10      agaagagagacg---acgacggcgttagcagggactgtcggctcctggtg
A0A8B9Y853_BCL2L10      agaagagagacg---acgacggcgttagcagggactgtcggctcctggtg
A0A4P8GLJ2_BCL2-01      aaccgggag------atgtcgcccctggtggacagcatcgccctgtggat
A0A8B9WT05_BCL2L2-      aacaaggag------atggagccacttgtgggacaagtgcaggagtggat
A0A8B9W7D1_MCL1-03      aatcaagaaagctgcatcgaaccactagcagaaagcat-----cacagat
A0A8B9W7D1_MCL1-04      aatcaagaaagctgcatcgaaccactagcagaaagcat-----cacagat
A0A8B9W7D1_MCL1-01      aatcaagaaagctgcatcgaaccactagcagaaagcat-----cacagat
A0A8B9W7D1_MCL1-02      aatcaagaaagctgcatcgaaccactagcagaaagcat-----cacagat
                                                                          

A0A8B9YDG7_BCL2A1-      ggc---------------------ccagaa--------------------
A0A8B9YDG7_BCL2A1-      ggcggagttc----------atcaccgaaaatacaggagagtggataaag
A0A8B9YDG7_BCL2A1-      ggcggagttc----------atcaccgaaaatacaggagagtggataaag
A0A8B9YDG7_BCL2A1-      ggcggagttc----------atcaccgaaaatacaggagagtggataaag
A0A8B9WB42_BCL2L1-      ggccacttac----------ctaaataaccacgtcaagccttggatccaa
A0A8B9X9C2_BCL2L1-      ggccacctac----------ctaaatgaccacctagagtcttggatccag
A0A8B9XQH5_BCL2L1-      ggccacttac----------ctgaatgaccacctagagccttggatccag
A0A8B9Y853_BCL2L10      gcccttctgtgtgctcagttctgcgaaaggcaccg--cgcctggctgatg
A0A8B9Y853_BCL2L10      gcccttctgtgtgctcagttctgcgaaaggcaccg--cgcctggctgatg
A0A4P8GLJ2_BCL2-01      gaccgagtac----------ctgaaccggcacctgcacacctggatccag
A0A8B9WT05_BCL2L2-      ggtggcctac----------ctggagacgaggctggctgactggatccac
A0A8B9W7D1_MCL1-03      gttctcgtaag---------gtcaaaacgagactggatagtcaaacaaa-
A0A8B9W7D1_MCL1-04      gttctcgtaag---------gtcaaaacgagactggatagtcaaacaaa-
A0A8B9W7D1_MCL1-01      gttctcgtaag---------gtcaaaacgagactggatagtcaaacaaa-
A0A8B9W7D1_MCL1-02      gttctcgtaag---------gtcaaaacgagactggatagtcaaacaaa-
                        *                                                 

A0A8B9YDG7_BCL2A1-      --------------ggtgtttacccataatgaatat---caaaagtccaa
A0A8B9YDG7_BCL2A1-      caaaatggaggctggg---------aaaatgggtttgtaaagaagtttga
A0A8B9YDG7_BCL2A1-      caaaatggaggctgggtgtttacccataatgaatat---caaaagtccaa
A0A8B9YDG7_BCL2A1-      caaaatggaggctgggtgtttacccataatgaatat---caaaagtccaa
A0A8B9WB42_BCL2L1-      gagaacggcgggtggg------------acacttttgtggaactctacga
A0A8B9X9C2_BCL2L1-      gagaacggcggctggg------------acacttctgtgaaactctgtga
A0A8B9XQH5_BCL2L1-      gagaacggcggctggg------------acacttttgtggaactctacgg
A0A8B9Y853_BCL2L10      gctaacggcggctggg------------atggattttgtctcttcttcag
A0A8B9Y853_BCL2L10      gctaacggcggctggg------------atggattttgtctcttcttcag
A0A4P8GLJ2_BCL2-01      gacaacggaggctggg------------acgcctttgtggagctgtat--
A0A8B9WT05_BCL2L2-      agcagtgggggctggg------------cggagttcacagctctatacgg
A0A8B9W7D1_MCL1-03      -------gaggctggg------------atgggtttgtggagttcttcca
A0A8B9W7D1_MCL1-04      -------gaggctggg------------atgggtttgtggagttcttcca
A0A8B9W7D1_MCL1-01      -------gaggctggg------------atgggtttgtggagttcttcca
A0A8B9W7D1_MCL1-02      -------gaggctggg-------------taagtttgt------------
                                      **                 *                

A0A8B9YDG7_BCL2A1-      aagagtgtccatctttctgagcatgccagatgaaattgagacagaggaga
A0A8B9YDG7_BCL2A1-      aaccaaatctggctggctga------------------------------
A0A8B9YDG7_BCL2A1-      aagagtgtccatctttctgagcatgccagatgaaattgagacagaggaga
A0A8B9YDG7_BCL2A1-      aagagtgtccatctttctgagcatgccagatgaaattgagacagaggaga
A0A8B9WB42_BCL2L1-      ------aagc-------------------aatacaacaaacgagag----
A0A8B9X9C2_BCL2L1-      ------aaac-------------------aatacaaccaccgagag----
A0A8B9XQH5_BCL2L1-      ------gaac-------------------aatgcagcagccgagag----
A0A8B9Y853_BCL2L10      ccactcattc-------------------cagccatcttgggaaag----
A0A8B9Y853_BCL2L10      ccactcattc-------------------cagccatcttgggaaag----
A0A4P8GLJ2_BCL2-01      ------ggcc-------------------ctagcat----gcggcc----
A0A8B9WT05_BCL2L2-      ggacggggcc-------------------ctggaggaggcgcggcg----
A0A8B9W7D1_MCL1-03      tgtagaggac-------------------ctagaag----gcggca----
A0A8B9W7D1_MCL1-04      tgtagaggac-------------------ctagaag----gcggca----
A0A8B9W7D1_MCL1-01      tgtagaggac-------------------ctagaag----gcggca----
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      tcatcaaggacattttccgacaaggcaaaacctgctttatccctcggtac
A0A8B9YDG7_BCL2A1-      -----------cttttctg-------------------------------
A0A8B9YDG7_BCL2A1-      tcatcaaggacattttccgacaaggcaaaacctgctttatccctcggtac
A0A8B9YDG7_BCL2A1-      tcatcaaggacattttccgacaaggcaaaacctgctttatccctcggtac
A0A8B9WB42_BCL2L1-      ----------------ccagaagggccaggagcgcttcaactcc------
A0A8B9X9C2_BCL2L1-      ----------------ccaaaagggccaggagcgcttcaacagctggtcc
A0A8B9XQH5_BCL2L1-      ----------------ccggaagggccaggagcgcttcaaccgctggttc
A0A8B9Y853_BCL2L10      ----------------acagctggtctggtttttcctctcatactggaca
A0A8B9Y853_BCL2L10      ----------------acagctggtctggtttttcctctcatactggaca
A0A4P8GLJ2_BCL2-01      ----------------cctgtttgatttctcctggctgtctctgaaggca
A0A8B9WT05_BCL2L2-      ----------------tctgcgggaggggaactgggcttcagtgaggaca
A0A8B9W7D1_MCL1-03      ----------------tc--------------------------agaaat
A0A8B9W7D1_MCL1-04      ----------------tc--------------------------agaaat
A0A8B9W7D1_MCL1-01      ----------------tc--------------------------agaaat
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      cagttgcagagcaatcacatggatatggtgaagttagcatcgccagagga
A0A8B9YDG7_BCL2A1-      -----------------------------gaagtta-------caggaaa
A0A8B9YDG7_BCL2A1-      cagttgcagagcaatcacatggatatggtgaagttagcatcgccagagga
A0A8B9YDG7_BCL2A1-      cagttgcagagcaatcacatggatatggtgaagttagcatcgccagagga
A0A8B9WB42_BCL2L1-      ---atttacactactg------------------------------ctgc
A0A8B9X9C2_BCL2L1-      ctgacgggcatgactt------------------------------cggc
A0A8B9XQH5_BCL2L1-      ctgacgggcatgactg------------------------------tggc
A0A8B9Y853_BCL2L10      gcaataatcataatctacttctggataaaattatcttttcttcacatagg
A0A8B9Y853_BCL2L10      gcaataatcataatctacttctggataaaattatcag---ccaacatgga
A0A4P8GLJ2_BCL2-01      ctgctcagtctggccc------------------------------tgg-
A0A8B9WT05_BCL2L2-      gtgctgacgggggctg------------------------------tggc
A0A8B9W7D1_MCL1-03      gtgctgct---ggctt------------------------------ttgc
A0A8B9W7D1_MCL1-04      gtgctgct---ggctt------------------------------ttgc
A0A8B9W7D1_MCL1-01      gtgctgct---ggctt------------------------------ttgc
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      aatcgcttcgctgcccagaacttcctggaa--------------------
A0A8B9YDG7_BCL2A1-      gatc-------------------tgtgaaa--------------------
A0A8B9YDG7_BCL2A1-      aatcgcttcgctgcccagaacttcctggaa--------------------
A0A8B9YDG7_BCL2A1-      aatcgcttcgctgcccagaacttcctggaa--------------------
A0A8B9WB42_BCL2L1-      tgttgcaggcctcgcaaacctcatttcaaacacaaaactttattcaaaat
A0A8B9X9C2_BCL2L1-      tggtacagctc---------------------------------------
A0A8B9XQH5_BCL2L1-      tggtgtggttc---------------------------------------
A0A8B9Y853_BCL2L10      tcctg-tgttcttgcca---------------------------------
A0A8B9Y853_BCL2L10      cccagccaagcttgtca---------------------------------
A0A4P8GLJ2_BCL2-01      --tgggcgcttgcatca---------------------------------
A0A8B9WT05_BCL2L2-      actgggggccctggtaa---------------------------------
A0A8B9W7D1_MCL1-03      aggtgttgccggagtag---------------------------------
A0A8B9W7D1_MCL1-04      aggtgttgccggagtag---------------------------------
A0A8B9W7D1_MCL1-01      agtcgatactagattgt---------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      -----------------cattcagcagcccggtgaggatgaagttctgga
A0A8B9YDG7_BCL2A1-      -----------------cattatgtcgcc---------tgaag-------
A0A8B9YDG7_BCL2A1-      -----------------cattcagcagcccggtgaggatgaagttctgga
A0A8B9YDG7_BCL2A1-      -----------------cattcagcagcccggtgaggatgaagttctgga
A0A8B9WB42_BCL2L1-      tggaccaaagatgcccatactatgtgggccactcaggctcaga-------
A0A8B9X9C2_BCL2L1-      -----------------tgctgggcttgctactcaact---ca-------
A0A8B9XQH5_BCL2L1-      -----------------tgctgggctcgctcttcagtcggaaa-------
A0A8B9Y853_BCL2L10      -----------------gacgtattccagctctttgacttacgtcaccat
A0A8B9Y853_BCL2L10      -----------------g--------cagccaggggaataacatctgtgt
A0A4P8GLJ2_BCL2-01      -----------------ccctgggt--gcctatctgggccata-------
A0A8B9WT05_BCL2L2-      -----------------ctgtaggg--gccttttttgctagca-------
A0A8B9W7D1_MCL1-03      -----------------gagctggtttggcatatctaataaga-------
A0A8B9W7D1_MCL1-04      -----------------gagctggtttggcatatctaataaga-------
A0A8B9W7D1_MCL1-01      -----------------atacagaaccagctgatgtaatggtatgcaacc
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ggaggccttgtcaacagggggacttgacctcatctttgtgccgggtctcg
A0A8B9YDG7_BCL2A1-      -----------caata----------------------------------
A0A8B9YDG7_BCL2A1-      ggaggccttgtcaacagggggacttgacctcatctttgtgccgggtctcg
A0A8B9YDG7_BCL2A1-      ggaggccttgtcaacag---------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      tgggaa--------------------------------------------
A0A8B9Y853_BCL2L10      ggataaaaagccagcc----------------------------------
A0A4P8GLJ2_BCL2-01      ---ag---------------------------------------------
A0A8B9WT05_BCL2L2-      ---ag---------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      tggtg---------------------------------------------
A0A8B9W7D1_MCL1-02      ---tt---------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ggttcgacaaacagagcaaccgtttgggacggggcaagggctactatgac
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ggttcgacaaacagagcaaccgtttgggacggggcaagggctactatgac
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      gcctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccct
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      gcctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccct
A0A8B9YDG7_BCL2A1-      ------------------ttgcagtc------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ggccttggctttcaaagagcagatctgcctccaggtcccggtgaatgaga
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ggccttggctttcaaagagcagatctgcctccaggtcccggtgaatgaga
A0A8B9YDG7_BCL2A1-      -----tgtctggtaa--------------------------tgagtgag-
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A4P8GLJ2_BCL2-01      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      atgatgtgaaggtagacgaagtgctttacgaagactcctga----
A0A8B9YDG7_BCL2A1-      ----------------------------------ctattga----
A0A8B9YDG7_BCL2A1-      atgatgtgaaggtagacgaagtgctttacgaagactcctga----
A0A8B9YDG7_BCL2A1-      --------------------------------------tga----
A0A8B9WB42_BCL2L1-      --------------------------------------cagatga
A0A8B9X9C2_BCL2L1-      --------------------------------------tag----
A0A8B9XQH5_BCL2L1-      --------------------------------------tga----
A0A8B9Y853_BCL2L10      --------------------------------------tag----
A0A8B9Y853_BCL2L10      --------------------------------------tag----
A0A4P8GLJ2_BCL2-01      --------------------------------------tga----
A0A8B9WT05_BCL2L2-      --------------------------------------tga----
A0A8B9W7D1_MCL1-03      --------------------------------------tag----
A0A8B9W7D1_MCL1-04      --------------------------------------tag----
A0A8B9W7D1_MCL1-01      --------------------------------------tag----
A0A8B9W7D1_MCL1-02      --------------------------------------taa----
                                                                     

© 1998-2022Legal notice