Dataset for CDS BCL-2-like of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9YDG7_BCL2A1-      ------atgg------------------------c-------------gg
A0A8B9YDG7_BCL2A1-      ------atga------------------------ctgacactgagtttgg
A0A8B9YDG7_BCL2A1-      ------atga------------------------ctgacactgagtttgg
A0A8B9YDG7_BCL2A1-      ------atga------------------------ctgacactgagtttgg
A0A8B9WB42_BCL2L1-      ------atgt------------------------ctcag-----------
A0A8B9X9C2_BCL2L1-      aaatttatct------------------------tacagggaaaggggta
A0A8B9XQH5_BCL2L1-      ------atgt------------------------ctcag-----------
A0A8B9Y853_BCL2L10      ------atgcgagaaggggcggggcgtcggcaggcccagaa---------
A0A8B9Y853_BCL2L10      ------atgcgagaaggggcggggcgtcggcaggcccagaa---------
A0A8B9WT05_BCL2L2-      ------atg-----gcgaccccagcctcggc---ccc---a---------
A0A8B9W7D1_MCL1-03      ------atg----------------ttcggc---ctcaaga---------
A0A8B9W7D1_MCL1-04      ------atg----------------ttcggc---ctcaaga---------
A0A8B9W7D1_MCL1-01      ------atg----------------ttcggc---ctcaaga---------
A0A8B9W7D1_MCL1-02      ------atg----------------ttcggc---ctcaaga---------
                              **                                          

A0A8B9YDG7_BCL2A1-      cagcgg--------tggccgtgagc-------------------------
A0A8B9YDG7_BCL2A1-      ctacgttcacgggctggctgaggact--atctgaaatatgtgtt------
A0A8B9YDG7_BCL2A1-      ctacgttcacgggctggctgaggact--atctgaaatatgtgtt------
A0A8B9YDG7_BCL2A1-      ctacgttcacgggctggctgaggact--atctgaaatatgtgtt------
A0A8B9WB42_BCL2L1-      -agcaatcgggaactagtggttgact--ttctctcttacaagctttccca
A0A8B9X9C2_BCL2L1-      tagcaaccgacggctggtggttgact--ttctctcttacaagctttccca
A0A8B9XQH5_BCL2L1-      -agtaaccgggagctggtggttgact--ttctctcttacaagctttccca
A0A8B9Y853_BCL2L10      -aacaggccg----gggt--cggacc--------------------cccg
A0A8B9Y853_BCL2L10      -aacaggccg----gggt--cggacc--------------------cccg
A0A8B9WT05_BCL2L2-      -gacacacgggctctagtggcagact---------ttgtgggcta-----
A0A8B9W7D1_MCL1-03      -gaaacgcag----taat--cggactaaacctctattgtgggggagccgg
A0A8B9W7D1_MCL1-04      -gaaacgcag----taat--cggactaaacctctattgtgggggagccgg
A0A8B9W7D1_MCL1-01      -gaaacgcag----taat--cggactaaacctctattgtgggggagccgg
A0A8B9W7D1_MCL1-02      -gaaacgcag----taat--cggactaaacctctattgtgggggagccgg
                                                *                         

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --gcagatacagcaac---------------------------------c
A0A8B9YDG7_BCL2A1-      --gcagatacagcaac---------------------------------c
A0A8B9YDG7_BCL2A1-      --gcagatacagcaac---------------------------------c
A0A8B9WB42_BCL2L1-      gaaaggatacagctggagtcagtttagtg---------------------
A0A8B9X9C2_BCL2L1-      gaaaggatacagctggagtcgatttaatgatgtggaagagaacagaactg
A0A8B9XQH5_BCL2L1-      gaaaggatacagctggagtcagtttagtgatgtggaagagaacagaactg
A0A8B9Y853_BCL2L10      gtagaggcggagccatggtggacccgttt------agggagcgcaccgcc
A0A8B9Y853_BCL2L10      gtagaggcggagccatggtggacccgttt------agggagcgcaccgcc
A0A8B9WT05_BCL2L2-      --taagctgaggcagaaggggtatgtttg------tggag---------c
A0A8B9W7D1_MCL1-03      attaggacagggcagcggcgcctcctctc------cgggggggcggcttt
A0A8B9W7D1_MCL1-04      attaggacagggcagcggcgcctcctctc------cgggggggcggcttt
A0A8B9W7D1_MCL1-01      attaggacagggcagcggcgcctcctctc------cgggggggcggcttt
A0A8B9W7D1_MCL1-02      attaggacagggcagcggcgcctcctctc------cgggggggcggcttt
                                                                          

A0A8B9YDG7_BCL2A1-      -ggcgccaagcggagc----------------------------------
A0A8B9YDG7_BCL2A1-      tggatccaagccaagcaaaatat---------------------------
A0A8B9YDG7_BCL2A1-      tggatccaagccaagcaaaatat---------------------------
A0A8B9YDG7_BCL2A1-      tggatccaagccaagcaaaatat---------------------------
A0A8B9WB42_BCL2L1-      --------------------tcagatatggaaac----------------
A0A8B9X9C2_BCL2L1-      aggcctcggaagggacaaaatcagatatggaaa-----------------
A0A8B9XQH5_BCL2L1-      aggccccagaagggacagaatcagatatggaaac----------------
A0A8B9Y853_BCL2L10      cggctgctgatggactacctggagttctgcg-------------------
A0A8B9Y853_BCL2L10      cggctgctgatggactacctggagttctgcg-------------------
A0A8B9WT05_BCL2L2-      tggccccggggaggg-----------------------------------
A0A8B9W7D1_MCL1-03      tggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaa
A0A8B9W7D1_MCL1-04      t-------------------------------------------------
A0A8B9W7D1_MCL1-01      tggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaa
A0A8B9W7D1_MCL1-02      tggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaa
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------ccagggtgtt--
A0A8B9YDG7_BCL2A1-      --------------------------------------ccagggtgtt--
A0A8B9YDG7_BCL2A1-      --------------------------------------ccagggtgtt--
A0A8B9WB42_BCL2L1-      --------------------------------------ccccagtg-g--
A0A8B9X9C2_BCL2L1-      --------------------------------------ccccaatgcc--
A0A8B9XQH5_BCL2L1-      --------------------------------------ccccagtgcc--
A0A8B9Y853_BCL2L10      --------------------------------------cccgggagcc--
A0A8B9Y853_BCL2L10      --------------------------------------cccgggagcc--
A0A8B9WT05_BCL2L2-      --------------------------------------cccagcagct--
A0A8B9W7D1_MCL1-03      gccggcacggtgattggcggaagcgccggcccgagccccccggccactct
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gccggcacggtgattggcggaagcgccggcccgagccccccggccactct
A0A8B9W7D1_MCL1-02      gccggcacggtgattggcggaagcgccggcccgagccccccggccactct
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8B9W7D1_MCL1-02      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8B9W7D1_MCL1-02      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      cgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccat
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccat
A0A8B9W7D1_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccat
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      catgtcgcccgaagaggagctggacgggtgcgagccagaccctctcggga
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      catgtcgcccgaagaggagctggacgggtgcgagccagaccctctcggga
A0A8B9W7D1_MCL1-02      catgtcgcccgaagaggagctggacgggtgcgagccagaccctctcggga
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      agcggcctgccgtccggcctttacctttgttggtcggagaagccagtaac
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      agcggcctgccgtccggcctttacctttgttggtcggagaagccagtaac
A0A8B9W7D1_MCL1-02      agcggcctgccgtccggcctttacctttgttggtcggagaagccagtaac
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      ------------atcagtggcaacccatcctggcacctggcagatagccc
A0A8B9X9C2_BCL2L1-      ------------atcaatgacaacccatctt-------------------
A0A8B9XQH5_BCL2L1-      ------------atcaatggcaacgcatcctggcacctggcggatagccc
A0A8B9Y853_BCL2L10      -----------------cggcactccagctc-------------------
A0A8B9Y853_BCL2L10      -----------------cggcactccagctc-------------------
A0A8B9WT05_BCL2L2-      ------------------gacccgctacac--------------------
A0A8B9W7D1_MCL1-03      aacagtccaggctcggacggctcgctgccct-------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      aacagtccaggctcggacggctcgctgccct-------------------
A0A8B9W7D1_MCL1-02      aacagtccaggctcggacggctcgctgccct-------------------
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------acaaga
A0A8B9YDG7_BCL2A1-      --------------------------------------------acaaga
A0A8B9YDG7_BCL2A1-      --------------------------------------------acaaga
A0A8B9WB42_BCL2L1-      cacagtgaatggagccactggccacagcagaagctt--------------
A0A8B9X9C2_BCL2L1-      -------------gccactggccacagcagaagctt--------------
A0A8B9XQH5_BCL2L1-      tgctgtgaatggagccactggccacagcagaagctc--------------
A0A8B9Y853_BCL2L10      ------------ctgcgccgtccacgcctgaggctgccgtgc-tgcgcca
A0A8B9Y853_BCL2L10      ------------ctgcgccgtccacgcctgaggctgccgtgc-tgcgcca
A0A8B9WT05_BCL2L2-      -------------------------------------------caagcca
A0A8B9W7D1_MCL1-03      ------------cgacgccgcccccagcagaggaggaggaggacgagtta
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      ------------cgacgccgcccccagcagaggaggaggaggacgagtta
A0A8B9W7D1_MCL1-02      ------------cgacgccgcccccagcagaggaggaggaggacgagtta
                                                                          

A0A8B9YDG7_BCL2A1-      -----------ctg--cgggccg---------------------------
A0A8B9YDG7_BCL2A1-      tgtggcttcctctgtccaggacg---------------------------
A0A8B9YDG7_BCL2A1-      tgtggcttcctctgtccaggacg---------------------------
A0A8B9YDG7_BCL2A1-      tgtggcttcctctgtccaggacg---------------------------
A0A8B9WB42_BCL2L1-      ---------ggatgcccagaaaacgatc----------------------
A0A8B9X9C2_BCL2L1-      ---------ggacgcctggaaagtgatc----------------------
A0A8B9XQH5_BCL2L1-      ---------ggatgcccgggaagtgatc----------------------
A0A8B9Y853_BCL2L10      cgtggccgcacgtatccaggaagcaaat----------------------
A0A8B9Y853_BCL2L10      cgtggccgcacgtatccaggaagcaaat----------------------
A0A8B9WT05_BCL2L2-      tgcgg----gcag---ctggagatgagttc-------------------g
A0A8B9W7D1_MCL1-03      tatcg----gcagtccctggagataatctctcagtacctccgggagcagg
A0A8B9W7D1_MCL1-04      ------------------------------------------------gg
A0A8B9W7D1_MCL1-01      tatcg----gcagtccctggagataatctctcagtacctccgggagcagg
A0A8B9W7D1_MCL1-02      tatcg----gcagtccctggagataatctctcagtacctccgggagcagg
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      ------------------------------------cccatgacaa----
A0A8B9X9C2_BCL2L1-      ------------------------------------cccgtgacaa----
A0A8B9XQH5_BCL2L1-      ------------------------------------cccatggcag----
A0A8B9Y853_BCL2L10      ------------------cgaaacgtcttgcc----cctataccgc----
A0A8B9Y853_BCL2L10      ------------------cgaaacgtcttgcc----cctataccgc----
A0A8B9WT05_BCL2L2-      agacccgcttc-------cggcgcaccttctccgatctggcagctc----
A0A8B9W7D1_MCL1-03      caaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagc
A0A8B9W7D1_MCL1-04      caaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagc
A0A8B9W7D1_MCL1-01      caaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagc
A0A8B9W7D1_MCL1-02      caaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagc
                                                                          

A0A8B9YDG7_BCL2A1-      ----ag------------ctgaagca------------------------
A0A8B9YDG7_BCL2A1-      ----aagtggaaaggactctgaagcagtgcttggataagttt--------
A0A8B9YDG7_BCL2A1-      ----aagtggaaaggactctgaagcagtgcttggataagttt--------
A0A8B9YDG7_BCL2A1-      ----aagtggaaaggactctgaagcagtgcttggataagttt--------
A0A8B9WB42_BCL2L1-      ----cagtaaagcaagccctgagggaggcaagcaatgagtttaaactgag
A0A8B9X9C2_BCL2L1-      ----cagaaaagcaagccctgagggaggcaggcaatga------------
A0A8B9XQH5_BCL2L1-      ----cggtgaagcaagccctgagggaggcaggcgatgagtttgaactgag
A0A8B9Y853_BCL2L10      ----cgctgccgcaggcaccgcgtcgagctggtgg---------------
A0A8B9Y853_BCL2L10      ----cgctgccgcaggcaccgcgtcgagctggtgg---------------
A0A8B9WT05_BCL2L2-      ----agctgcatgtgaccccgggc----tcgg------------------
A0A8B9W7D1_MCL1-03      cggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaa
A0A8B9W7D1_MCL1-04      cggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaa
A0A8B9W7D1_MCL1-01      cggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaa
A0A8B9W7D1_MCL1-02      cggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaa
                                          * *                             

A0A8B9YDG7_BCL2A1-      -------------------------gcgtctgcgggcgctg---------
A0A8B9YDG7_BCL2A1-      -------------------gatgtggtgtccgtagacactgccagaac--
A0A8B9YDG7_BCL2A1-      -------------------gatgtggtgtccgtagacactgccagaac--
A0A8B9YDG7_BCL2A1-      -------------------gatgtggtgtccgtagacactgccagaac--
A0A8B9WB42_BCL2L1-      gtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccag
A0A8B9X9C2_BCL2L1-      ------------------cgaccagacgtcccagctccacatcaccccag
A0A8B9XQH5_BCL2L1-      gtaccgacgggcattcagcgacctgacgtcccagctccacatcaccccag
A0A8B9Y853_BCL2L10      ---------------ccagg--atggcgcagaggctactcgacg-aag--
A0A8B9Y853_BCL2L10      ---------------ccagg--atggcgcagaggctactcgacg-aag--
A0A8B9WT05_BCL2L2-      ---------------cccagcaacgcttc---------------------
A0A8B9W7D1_MCL1-03      ccacgagacggctttccaaggcatgcttcggaaactggacatca-aaaac
A0A8B9W7D1_MCL1-04      ccacgagacggctttccaaggcatgcttcggaaactggacatca-aaaac
A0A8B9W7D1_MCL1-01      ccacgagacggctttccaaggcatgcttcggaaactggacatca-aaaac
A0A8B9W7D1_MCL1-02      ccacgagacggctttccaaggcatgcttcggaaactggacatca-aaaac
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------agcgctg-----------------
A0A8B9YDG7_BCL2A1-      --------------aatattcaaccaagtgatggaaaaggaatttgaaga
A0A8B9YDG7_BCL2A1-      --------------aatattcaaccaagtgatggaaaaggaatttgaaga
A0A8B9YDG7_BCL2A1-      --------------aatattcaaccaagtgatggaaaaggaatttgaaga
A0A8B9WB42_BCL2L1-      ggacagcatgtcagagctttgaa-caggtaataaatgaactcttccggga
A0A8B9X9C2_BCL2L1-      ggacagcatatcagagctttgaa-cagatgatgtatgaactcctccagga
A0A8B9XQH5_BCL2L1-      ggacagcatatcagagctttgaa-caggtagtgaatgaactcttccggga
A0A8B9Y853_BCL2L10      --------------accctggcc---------------------------
A0A8B9Y853_BCL2L10      --------------accctggcc---------------------------
A0A8B9WT05_BCL2L2-      --------------acccaggtctctgatga------actcttccaa---
A0A8B9W7D1_MCL1-03      gaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtga
A0A8B9W7D1_MCL1-04      gaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtga
A0A8B9W7D1_MCL1-01      gaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtga
A0A8B9W7D1_MCL1-02      gaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtga
                                                                          

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      tggcattgttaactggggcaggattgtaaccatattcgcctttgaaggta
A0A8B9YDG7_BCL2A1-      tggcattgttaactggggcaggattgtaaccatattcgcctttgaaggta
A0A8B9YDG7_BCL2A1-      tggcattgttaactggggcaggattgtaaccatattcgcctttgaaggta
A0A8B9WB42_BCL2L1-      caggg---tgaagtggggtcacgttgtggcctttttctccttcagtggga
A0A8B9X9C2_BCL2L1-      cgggg---tgaactggggtcgcattgtggcctttttttccttcagtgggg
A0A8B9XQH5_BCL2L1-      cgggg---tgaactggggtcgcattgtggcctttttctccttcggtgggg
A0A8B9Y853_BCL2L10      --------ccagctggggccgcgtggcctcactcgtgacctttgcggggt
A0A8B9Y853_BCL2L10      --------ccagctggggccgcgtggcctcactcgtgacctttgcggggt
A0A8B9WT05_BCL2L2-      -gggggccccaactggggccgccttgtggccttctttgtctttggagccg
A0A8B9W7D1_MCL1-03      cggagtaacaaactggggcaggattgtgactcttatttcttttggtgc--
A0A8B9W7D1_MCL1-04      cggagtaacaaactggggcaggattgtgactcttatttcttttggtgc--
A0A8B9W7D1_MCL1-01      cggagtaacaaactggggcaggattgtgactcttatttcttttggtgc--
A0A8B9W7D1_MCL1-02      cggagtaacaaactggggcaggattgtgactcttatttcttttggtgc--
                                                                          

A0A8B9YDG7_BCL2A1-      ---------aggagcggctgcgccag------------------------
A0A8B9YDG7_BCL2A1-      ttcttaccaagaaacttctgggcaagtgtattgcctcagacatggacatg
A0A8B9YDG7_BCL2A1-      ttcttaccaagaaacttctgggcaagtgtattgcctcagacatggacatg
A0A8B9YDG7_BCL2A1-      ttcttaccaagaaacttctgggcaagtgtattgcctcagacatggacatg
A0A8B9WB42_BCL2L1-      cactgtgc------------------------------------------
A0A8B9X9C2_BCL2L1-      cactatgc------------------------------------------
A0A8B9XQH5_BCL2L1-      cactgtgc------------------------------------------
A0A8B9Y853_BCL2L10      cgctgctggagaggccaccgcagacg------------------------
A0A8B9Y853_BCL2L10      cgctgctggagaggccaccgcagacg------------------------
A0A8B9WT05_BCL2L2-      cgttgtgt-----------gc-----------------------------
A0A8B9W7D1_MCL1-03      ctttgtgg-----------ccaaaca------------------------
A0A8B9W7D1_MCL1-04      ctttgtgg-----------ccaaaca------------------------
A0A8B9W7D1_MCL1-01      ctttgtgg-----------ccaaaca------------------------
A0A8B9W7D1_MCL1-02      ctttgtgg-----------ccaaaca------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ------------tcccacctcttggc-----------ccagaa-------
A0A8B9YDG7_BCL2A1-      tgcaaggacatttcttactttgtggcggagttcatcaccgaaaat-----
A0A8B9YDG7_BCL2A1-      tgcaaggacatttcttactttgtggcggagttcatcaccgaaaat-----
A0A8B9YDG7_BCL2A1-      tgcaaggacatttcttactttgtggcggagttcatcaccgaaaat-----
A0A8B9WB42_BCL2L1-      ------------------------atgaaaagcatagacaaggag-----
A0A8B9X9C2_BCL2L1-      ------------------------atggaaagcatagacaaggag-----
A0A8B9XQH5_BCL2L1-      ------------------------gtggaaagcgtagacaaggag-----
A0A8B9Y853_BCL2L10      -----------------------acccgacggcaggagaagagagacg--
A0A8B9Y853_BCL2L10      -----------------------acccgacggcaggagaagagagacg--
A0A8B9WT05_BCL2L2-      --------------------------tgagagtgtcaacaaggag-----
A0A8B9W7D1_MCL1-03      -----------------------cttgaagagtataaatcaagaaagctg
A0A8B9W7D1_MCL1-04      -----------------------cttgaagagtataaatcaagaaagctg
A0A8B9W7D1_MCL1-01      -----------------------cttgaagagtataaatcaagaaagctg
A0A8B9W7D1_MCL1-02      -----------------------cttgaagagtataaatcaagaaagctg
                                                                          

A0A8B9YDG7_BCL2A1-      ---------------------------------ggtgt---ttacccata
A0A8B9YDG7_BCL2A1-      -acaggagagtggataaagcaaaatggaggctggg------------aaa
A0A8B9YDG7_BCL2A1-      -acaggagagtggataaagcaaaatggaggctgggtgt---ttacccata
A0A8B9YDG7_BCL2A1-      -acaggagagtggataaagcaaaatggaggctgggtgt---ttacccata
A0A8B9WB42_BCL2L1-      -atacacgtattggtgagtcaggtcacaacttcaatgg---ccacttac-
A0A8B9X9C2_BCL2L1-      -acacaagtattggtgagtcaaagcacaacttggatgg---ccacctac-
A0A8B9XQH5_BCL2L1-      -atgcaggtattggtgagtcggatcgcaacttggatgg---ccacttac-
A0A8B9Y853_BCL2L10      -acgacggcgttagcagggactgt-cggctcctggtggcccttctgtgtg
A0A8B9Y853_BCL2L10      -acgacggcgttagcagggactgt-cggctcctggtggcccttctgtgtg
A0A8B9WT05_BCL2L2-      -atggagccacttgtgggacaagtgcaggagtggatgg---tggcctac-
A0A8B9W7D1_MCL1-03      catcgaaccactagcagaaagcat-----cacagatgt---tctcgtaag
A0A8B9W7D1_MCL1-04      catcgaaccactagcagaaagcat-----cacagatgt---tctcgtaag
A0A8B9W7D1_MCL1-01      catcgaaccactagcagaaagcat-----cacagatgt---tctcgtaag
A0A8B9W7D1_MCL1-02      catcgaaccactagcagaaagcat-----cacagatgt---tctcgtaag
                                                                          

A0A8B9YDG7_BCL2A1-      atgaatat---caaaagtccaaaagagtgtccatctttctgagcatgcca
A0A8B9YDG7_BCL2A1-      atgggtttgtaaagaagtttgaaaccaaatctggctggctga--------
A0A8B9YDG7_BCL2A1-      atgaatat---caaaagtccaaaagagtgtccatctttctgagcatgcca
A0A8B9YDG7_BCL2A1-      atgaatat---caaaagtccaaaagagtgtccatctttctgagcatgcca
A0A8B9WB42_BCL2L1-      ctaaa------taaccacgtcaa---------gccttg-------gatcc
A0A8B9X9C2_BCL2L1-      ctaaa------tgaccacctaga---------gtcttg-------gatcc
A0A8B9XQH5_BCL2L1-      ctgaa------tgaccacctaga---------gccttg-------gatcc
A0A8B9Y853_BCL2L10      ctcagttctgcgaaaggcaccgc---------gcctggctgat--ggcta
A0A8B9Y853_BCL2L10      ctcagttctgcgaaaggcaccgc---------gcctggctgat--ggcta
A0A8B9WT05_BCL2L2-      ctgga-------------gacga---------ggctggctgactggatcc
A0A8B9W7D1_MCL1-03      gtcaa-------------aacga---------gactggatagtcaaacaa
A0A8B9W7D1_MCL1-04      gtcaa-------------aacga---------gactggatagtcaaacaa
A0A8B9W7D1_MCL1-01      gtcaa-------------aacga---------gactggatagtcaaacaa
A0A8B9W7D1_MCL1-02      gtcaa-------------aacga---------gactggatagtcaaacaa
                         *                                **              

A0A8B9YDG7_BCL2A1-      gatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaa
A0A8B9YDG7_BCL2A1-      ---------------------------------cttttctg---------
A0A8B9YDG7_BCL2A1-      gatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaa
A0A8B9YDG7_BCL2A1-      gatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaa
A0A8B9WB42_BCL2L1-      aagagaacggcgggtgggacact--tttgtggaactctacgaaagc----
A0A8B9X9C2_BCL2L1-      aggagaacggcggctgggacact--tctgtgaaactctgtgaaaac----
A0A8B9XQH5_BCL2L1-      aggagaacggcggctgggacact--tttgtggaactctacgggaac----
A0A8B9Y853_BCL2L10      a------cggcggctgggatgga--ttttgtctcttcttcagccactcat
A0A8B9Y853_BCL2L10      a------cggcggctgggatgga--ttttgtctcttcttcagccactcat
A0A8B9WT05_BCL2L2-      acagcagtgggggctgggcggag--ttcacagctctatacggggacgggg
A0A8B9W7D1_MCL1-03      a--------gaggctgggatggg--tttgtggagttcttccatgtagagg
A0A8B9W7D1_MCL1-04      a--------gaggctgggatggg--tttgtggagttcttccatgtagagg
A0A8B9W7D1_MCL1-01      a--------gaggctgggatggg--tttgtggagttcttccatgtagagg
A0A8B9W7D1_MCL1-02      a--------gaggctggg-taag--tttgt--------------------
                                                                          

A0A8B9YDG7_BCL2A1-      aacctgctttatccctcggtaccagttgcagagcaatcacatggatatgg
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      aacctgctttatccctcggtaccagttgcagagcaatcacatggatatgg
A0A8B9YDG7_BCL2A1-      aacctgctttatccctcggtaccagttgcagagcaatcacatggatatgg
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      tcc-----------------------------------------------
A0A8B9Y853_BCL2L10      tcc-----------------------------------------------
A0A8B9WT05_BCL2L2-      ccct---------------------------------------ggaggag
A0A8B9W7D1_MCL1-03      acct---------------------------------------agaag--
A0A8B9W7D1_MCL1-04      acct---------------------------------------agaag--
A0A8B9W7D1_MCL1-01      acct---------------------------------------agaag--
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      tgaagttagcatcgccagaggaaatcgcttcgctgcccagaacttcctgg
A0A8B9YDG7_BCL2A1-      -gaagtta-------caggaaagatc-------------------tgtga
A0A8B9YDG7_BCL2A1-      tgaagttagcatcgccagaggaaatcgcttcgctgcccagaacttcctgg
A0A8B9YDG7_BCL2A1-      tgaagttagcatcgccagaggaaatcgcttcgctgcccagaacttcctgg
A0A8B9WB42_BCL2L1-      --aatacaacaaacgagagccagaagggcc-----------------agg
A0A8B9X9C2_BCL2L1-      --aatacaaccaccgagagccaaaagggcc-----------------agg
A0A8B9XQH5_BCL2L1-      --aatgcagcagccgagagccggaagggcc-----------------agg
A0A8B9Y853_BCL2L10      ---agccatcttgggaaagacagctggtctggtttttcctctcatactgg
A0A8B9Y853_BCL2L10      ---agccatcttgggaaagacagctggtctggtttttcctctcatactgg
A0A8B9WT05_BCL2L2-      gcgcggcgtctgcgggaggggaactgggct-----------tcagtgagg
A0A8B9W7D1_MCL1-03      --gcggcatc-------------------------------------aga
A0A8B9W7D1_MCL1-04      --gcggcatc-------------------------------------aga
A0A8B9W7D1_MCL1-01      --gcggcatc-------------------------------------aga
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      aacatt-----cagcagcccggtgaggatgaagtt--------ctggagg
A0A8B9YDG7_BCL2A1-      aacatt-----atgtcgcc---------tgaag-----------------
A0A8B9YDG7_BCL2A1-      aacatt-----cagcagcccggtgaggatgaagtt--------ctggagg
A0A8B9YDG7_BCL2A1-      aacatt-----cagcagcccggtgaggatgaagtt--------ctggagg
A0A8B9WB42_BCL2L1-      agcgct----tcaactcc---------atttacactactgctgctgttgc
A0A8B9X9C2_BCL2L1-      agcgct----tcaacagctggtccctgacgggcatgacttcggctggtac
A0A8B9XQH5_BCL2L1-      agcgct----tcaaccgctggttcctgacgggcatgactgtggctggtgt
A0A8B9Y853_BCL2L10      acagcaataatcataatctacttctggataaaattatcttttcttcacat
A0A8B9Y853_BCL2L10      acagcaataatcataatctacttctggataaaattatcag---ccaacat
A0A8B9WT05_BCL2L2-      acagtg-------------------------------------ctgacgg
A0A8B9W7D1_MCL1-03      aatgtg-------------------------------------ctgct--
A0A8B9W7D1_MCL1-04      aatgtg-------------------------------------ctgct--
A0A8B9W7D1_MCL1-01      aatgtg-------------------------------------ctgct--
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      aggccttgtcaacagggggacttgacctcatctttgtgccgggtctcggg
A0A8B9YDG7_BCL2A1-      ---------caata------------------------------------
A0A8B9YDG7_BCL2A1-      aggccttgtcaacagggggacttgacctcatctttgtgccgggtctcggg
A0A8B9YDG7_BCL2A1-      aggccttgtcaacag-----------------------------------
A0A8B9WB42_BCL2L1-      aggcctcgcaaacct-----------------------------------
A0A8B9X9C2_BCL2L1-      agctc---------------------------------------------
A0A8B9XQH5_BCL2L1-      ggttc---------------------------------------------
A0A8B9Y853_BCL2L10      aggtcctg-tgttct-----------------------------------
A0A8B9Y853_BCL2L10      ggacccagccaagct-----------------------------------
A0A8B9WT05_BCL2L2-      gggctgtggcactgg-----------------------------------
A0A8B9W7D1_MCL1-03      -ggcttttgcaggtg-----------------------------------
A0A8B9W7D1_MCL1-04      -ggcttttgcaggtg-----------------------------------
A0A8B9W7D1_MCL1-01      -ggcttttgcagtcg-----------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccctgg
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccctgg
A0A8B9YDG7_BCL2A1-      ----------------ttgcagtc--------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9Y853_BCL2L10      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ccttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaat
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ccttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaat
A0A8B9YDG7_BCL2A1-      ---tgtctggtaa--------------------------tgagtgag---
A0A8B9WB42_BCL2L1-      ---catttcaaacacaaaactttattcaaaattggaccaaagatgcccat
A0A8B9X9C2_BCL2L1-      -------------------------------------------------t
A0A8B9XQH5_BCL2L1-      -------------------------------------------------t
A0A8B9Y853_BCL2L10      ---tgccagacgtattccagc----------------------------t
A0A8B9Y853_BCL2L10      ---tgtcag--------cagc----------------------------c
A0A8B9WT05_BCL2L2-      ---gggccctgg-----taac----------------------------t
A0A8B9W7D1_MCL1-03      ---ttgccggag-----tagg----------------------------a
A0A8B9W7D1_MCL1-04      ---ttgccggag-----tagg----------------------------a
A0A8B9W7D1_MCL1-01      ---atactagat-----tgta----------------------------t
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      gatgtgaaggtagacgaagtgctttacgaagactcctga----
A0A8B9YDG7_BCL2A1-      --------------------------------ctattga----
A0A8B9YDG7_BCL2A1-      gatgtgaaggtagacgaagtgctttacgaagactcctga----
A0A8B9YDG7_BCL2A1-      ------------------------------------tga----
A0A8B9WB42_BCL2L1-      actatgtgggccactcaggctcag-----------acagatga
A0A8B9X9C2_BCL2L1-      gctgggcttgctactcaact---c-----------atag----
A0A8B9XQH5_BCL2L1-      gctgggctcgctcttcagtcggaa-----------atga----
A0A8B9Y853_BCL2L10      ctttgacttacgtcaccattggga-a----------tag----
A0A8B9Y853_BCL2L10      aggggaataacatctgtgtggata-aaaagccagcctag----
A0A8B9WT05_BCL2L2-      gtaggg--gccttttttgctagca----------agtga----
A0A8B9W7D1_MCL1-03      gctggtttggcatatctaataaga------------tag----
A0A8B9W7D1_MCL1-04      gctggtttggcatatctaataaga------------tag----
A0A8B9W7D1_MCL1-01      acagaaccagctgatgtaatggtatgcaacctggtgtag----
A0A8B9W7D1_MCL1-02      ----------------------------------tttaa----
                                                                   

© 1998-2023Legal notice