Dataset for CDS BCL-2-like of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A4W5JPK5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcagtt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcaaagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggttggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A4W5KV00_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgctgaggaggaggaaggtgctgctaataatgagttgatgatttctcctcgcccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgttcctcgtctttccaaatggctctcccaaccggacccacatgcagcaatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagccagacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacctcgcaagtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaagcctttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A4W5KYB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=765 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacgtatacaacacaggcggacactgcaggtacctcgcggacaggtacaccaatc
gagaagaggagataatgctcatactggggaaggaacggtacaggaagggaacagtcgcgttccctgaaaccatggaaacc
tgtgatgctctggacacagacaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtg
gaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggta
tgatcaacacactctacatggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagac
gggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggag
agacaactgtgtggaggcggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacaca
actcctggaacggtttcgtggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtc
ggattggctggtattggggcagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LF91_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=666 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacag
acaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctg
tcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacat
ggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggcc
gcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcg
gtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgt
ggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattgggg
cagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=879 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcaggaattcagcagattag
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=1050 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcagatcccaccatccctctc
tgctgtcctccgcagtttttgagctttctccattgataatgaatgaagaacggcggcttatttcatctgaggcacctctt
tcagatagttttccagatggaaatgcaatatatagatctgtactcgattctctattctacaaggcaaagggtcttggctg
ttgtaggtga
>gnl|bcl2dbcds|A0A4W5LYF9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtaagccttcttctcctcaggggggcattgaggcagtgaaagcagcactacgggactccgttgatgag
tttgagctacgctacacccgcgccttcagtgatctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtaaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccccctggtgatgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagtcaaggaggatgggaccgttttgcattgatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtcatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A4W5LZB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=585 residues).
atgaataacacccatggagttgcatgtacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacaga
caccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctgt
caacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacatg
gatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccg
cgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcgg
tgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtg
gagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggc
agcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5MLY7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Hucho hucho GN=BCL2L10 (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcccggaaagccccgcccggtcctcctcccagcgactcagctgcagccatgcggtgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctagcacacagcttcctgtgccaatgcgggccgaacccctgcgccagtctgaggagg
gtgatggaggagctggtgggagacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggt
tagagaactacagggggaggacacggaccaggcgctggggaatggcatggggctgggggggaaggagagctgcagggcgc
tggctgagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
>gnl|bcl2dbcds|A0A4W5NQ40_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=699 residues).
atgatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagggactaccccttcaacca
cattgagctcacggaagcccagaatcggactgaggggggacaggtggaagggggtgcggcagtcatgacatatgtcaacg
gcacagtgaacgggacgagtcccgggactccaccaccacagcagtcgcccccctcctcccctcggcggacagcaggcctg
gacgcagtgaaagaggcgttgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacctgtcctc
ccagctacacatcacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggtgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtg
ggaaggatcacagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
gtttgcagagatctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcgg
ggatgacgctggttacaggagtcgtcgtagggtcactctttgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5NW18_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaagcagaaaacgattatccaaataatggctttggggacccctctgcaccgaacacccgcgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctcaacagggtcctgcgcgaggcgggtgacgagattggaagaatttatcacccggactttgcagagatgtc
ggggcagttgcattttacgcccaacacggcacagagaaggtttacggctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgcccgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccattggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=789 residues).
atggaaacagccaagcggaaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagcccttcgttgaagctgg
ctggaccgtgcgaagactagacatcgacagtcgacacggtgctgatatcgttgtggacatacgaaagtgggaccctttgg
actctgtcagtgctagagctcggatgaataacacccatggagttgcatgtgtatataagtgccaacgctgtaaagggatc
ctgagtagttgtgagcttgaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaata
tacgggacttctgaaacgtgggtggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggaga
aacacagatacacatacaatggtatgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtaca
ctagcccatatcatctttcgagacgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtg
tcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcacc
acaaggactggctagtcaaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcg
aggaacatcatcgcgacccttgtcggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=606 residues).
gcagataaagtcacagttaaccgagcccgggcaggtgacaatggaaacagccaagcggaaaacatatcacatcaggaaac
ctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaatatacgggacttctgaaacgtgggt
ggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggt
atgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgaga
cgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgagggga
gagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacac
aactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcgaggaacatcatcgcgacccttgt
cggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5QGT1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=852 residues).
atgagtctgtcgaagtccattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtaccttgctaa
tgatgctagccctttgtgctatttcaacggggctggggcgtcaccgacgtctaaagtggacttgggaaatgggactggcg
atactccaccacgacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgataatcatttgtcagaccgaagc
aacaatgacgactctgacgattctttgccgtgcactccccagatggcgtcagaatgtgggcctgagctatcgaattgtcc
atcgggcgatgaagtattggaacatgataccagacaactaattgaacattttttgagggactacacaggactgtctcagc
ctcgttggaagcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatacgcattc
aatggtatgatcgccaaacttgacttggatgatcgatgcgatgacatgcgcgtcatcaattctgtggccaagaccatgtt
cggtgatagggtcacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctgaaggaga
atggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcctagc
ctttgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactttcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacacacc
ccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacctgtc
ctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtgtga
actggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactttcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtg
tgaactggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
© 1998-2020Legal notice